Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of YiaJ regulog to Shigella dysenteriae 1012

Reference regulog properties
Source regulog: YiaJ - Enterobacteriales
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor
Biological process: L-lyxose utilization
Effector: Ascorbate-6-phosphate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shigella dysenteriae 1012
Orthologous TF(s) Sdys1_01000076
Regulated genes 1
Built upon 8 sites [see more]
Predicted regulatory interactions in Shigella dysenteriae 1012
Locus tag Position Score Sequence
Position: -70
Score: 6.2
Sequence: ATTTGAAATGAAGTTTCGCAT
Locus tag: Sdys1_01000075
Sdys1_01000075 -70 6.2 ATTTGAAATGAAGTTTCGCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yiaK
Ortholog function: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
Escherichia coli str. K-12 substr. MG1655 b3575 -70 6.4 ATTTGAAATCAAGTTTCGCAT
Salmonella typhimurium LT2 STM3668 -82 6 ATTTGGAACTAGATTTCGCAT
Citrobacter koseri ATCC BAA-895 CKO_05033 -72 6.5 ATTTGAAATCAGATTTCGCAT
Serratia proteamaculans 568 Spro_3933 -74 6.1 ATTTGAAATGCAATTCCGCAT
© 2009-2020 RegPrecise