Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of TrpR regulog to Shigella dysenteriae 1012

Reference regulog properties
Source regulog: TrpR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Tryptophan biosynthesis
Effector: Tryptophan
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shigella dysenteriae 1012
Orthologous TF(s) No orthologous TFs found
Regulated genes 1
Built upon 44 sites [see more]
Predicted regulatory interactions in Shigella dysenteriae 1012
Locus tag Position Score Sequence
Position: -136
Score: 5.6
Sequence: TGTACTAGTTTGATGGTATG
Locus tag: Sdys1_01001310
Sdys1_01001310 -136 5.6 TGTACTAGTTTGATGGTATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: aroL
Ortholog function: Shikimate kinase III (EC 2.7.1.71)
Escherichia coli str. K-12 substr. MG1655 b0388 -79 5.6 TGTACTAGTTTGATGGTATG
Salmonella typhimurium LT2 STM0388 -79 5.1 TGTACTAGTTAGATGATATG
Citrobacter koseri ATCC BAA-895 CKO_02783 -136 5.4 TGTACTAGTTTGGTGGTATG
Enterobacter sp. 638 Ent638_0859 -80 5.6 CGTACTAGTTTAATGGTATT
© 2009-2020 RegPrecise