Propagation of SdaR regulog to Yersinia intermedia ATCC 29909
| Source regulog: | SdaR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | SdaR |
| Regulation mode: | activator |
| Biological process: | Glucarate utilization; Galactarate utilization |
| Effector: | Glycerate |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Yersinia intermedia ATCC 29909 |
| Orthologous TF(s) | YintA_01003044 |
| Regulated genes | 4 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -240
Score: 4.9 Sequence: TATTGTGCATCTGCCTATAA
Locus tag: YintA_01003041
|
||||
| YintA_01003041 | -240 | 4.9 | TATTGTGCATCTGCCTATAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: garL | ||||
| Ortholog function: 2-dehydro-3-deoxyglucarate aldolase (EC 4.1.2.20) | ||||
| Escherichia coli str. K-12 substr. MG1655 | b3126 | -186 | 6 | TTATGTGCATATGCTCAAAA |
| -144 | 4.5 | AAATTAGCATTTGCACAATG | ||
| Salmonella typhimurium LT2 | STM3249 | -316 | 5.1 | TCATGGGCGTATGCTCAAAA |
| -273 | 4.8 | TAATGAGCGTTTGCACAATG | ||
| Citrobacter koseri ATCC BAA-895 | CKO_04523 | -203 | 5.6 | CGTTGTGCAAATGCTCAAAA |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_03538 | -206 | 4.7 | CTTATGGCATAAGCACAATT |
| Enterobacter sp. 638 | Ent638_3568 | -208 | 5.4 | GGTTGTGCATATGCTCAAAT |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA3574 | -358 | 4.1 | TGCTGGGCTATTGCCCAATG |
|
Position: -184
Score: 4.7 Sequence: TTTTGGGCCGATGCACAATG
Locus tag: YintA_01003046
|
||||
| YintA_01003046 | -184 | 4.7 | TTTTGGGCCGATGCACAATG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: garP | ||||
| Ortholog function: D-galactarate permease, MFS family | ||||
| Escherichia coli str. K-12 substr. MG1655 | b3127 | -186 | 6 | TTATGTGCATATGCTCAAAA |
| -144 | 4.5 | AAATTAGCATTTGCACAATG | ||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_03539 | -206 | 4.7 | CTTATGGCATAAGCACAATT |
| Enterobacter sp. 638 | Ent638_3569 | -208 | 5.4 | GGTTGTGCATATGCTCAAAT |