Propagation of SdaR regulog to Yersinia intermedia ATCC 29909

Reference regulog properties
Source regulog:	SdaR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	SdaR
Regulation mode:	activator
Biological process:	Glucarate utilization; Galactarate utilization
Effector:	Glycerate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Yersinia intermedia ATCC 29909
Orthologous TF(s)	YintA_01003044
Regulated genes	4

Built upon 31 sites [see more]

Predicted regulatory interactions in *Yersinia intermedia ATCC 29909*
	Locus tag	Position	Score	Sequence
Position: -240 Score: 4.9 Sequence: TATTGTGCATCTGCCTATAA Locus tag: YintA_01003041
	YintA_01003041	-240	4.9	TATTGTGCATCTGCCTATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: garL
Ortholog function: 2-dehydro-3-deoxyglucarate aldolase (EC 4.1.2.20)
Escherichia coli str. K-12 substr. MG1655	b3126	-186	6	TTATGTGCATATGCTCAAAA
		-144	4.5	AAATTAGCATTTGCACAATG
Salmonella typhimurium LT2	STM3249	-316	5.1	TCATGGGCGTATGCTCAAAA
		-273	4.8	TAATGAGCGTTTGCACAATG
Citrobacter koseri ATCC BAA-895	CKO_04523	-203	5.6	CGTTGTGCAAATGCTCAAAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_03538	-206	4.7	CTTATGGCATAAGCACAATT
Enterobacter sp. 638	Ent638_3568	-208	5.4	GGTTGTGCATATGCTCAAAT
Erwinia carotovora subsp. atroseptica SCRI1043	ECA3574	-358	4.1	TGCTGGGCTATTGCCCAATG

Position: -184 Score: 4.7 Sequence: TTTTGGGCCGATGCACAATG Locus tag: YintA_01003046
	YintA_01003046	-184	4.7	TTTTGGGCCGATGCACAATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: garP
Ortholog function: D-galactarate permease, MFS family
Escherichia coli str. K-12 substr. MG1655	b3127	-186	6	TTATGTGCATATGCTCAAAA
		-144	4.5	AAATTAGCATTTGCACAATG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_03539	-206	4.7	CTTATGGCATAAGCACAATT
Enterobacter sp. 638	Ent638_3569	-208	5.4	GGTTGTGCATATGCTCAAAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --