Propagation of YiaJ regulog to Yersinia intermedia ATCC 29909
| Source regulog: | YiaJ - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor |
| Biological process: | L-lyxose utilization |
| Effector: | Ascorbate-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Yersinia intermedia ATCC 29909 |
| Orthologous TF(s) | YintA_01000192 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -249
Score: 6.2 Sequence: ATGCGAAATCAGATTTCAAAA
Locus tag: YintA_01000192
|
||||
| YintA_01000192 | -249 | 6.2 | ATGCGAAATCAGATTTCAAAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: yiaJ | ||||
| Ortholog function: transcriptional regulator of L-lyxose catabolism, IclR family | ||||
| Serratia proteamaculans 568 | Spro_3928 | -287 | 6.1 | ATGCGAAATTCAATTTCAAAA |