Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of FadR regulog to Geobacillus sp. Y412MC10

Reference regulog properties
Source regulog: FadR - Bacillales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Palmitoyl-CoA; Oleoyl-CoA
Phylum: Firmicutes
Propagated regulon:
Target genome Geobacillus sp. Y412MC10
Orthologous TF(s) GYMC10_0258
Regulated genes 1
Built upon 48 sites [see more]
Predicted regulatory interactions in Geobacillus sp. Y412MC10
Locus tag Position Score Sequence
Position: -54
Score: 6.9
Sequence: ATGAATGAGTATTCATTCAT
Locus tag: GYMC10_0258
GYMC10_0258 -54 6.9 ATGAATGAGTATTCATTCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: fadR
Ortholog function: Transcriptional regulator of fatty acids degradation, TetR family
Bacillus subtilis subsp. subtilis str. 168 BSU28550 -44 6.9 ATGAATGAATAGTCATTCAT
Bacillus amyloliquefaciens FZB42 RBAM_025610 -38 6.9 ATGAATGAATAGTCATTCAT
Bacillus pumilus SAFR-032 BPUM_2512 -41 6.8 ATGAATGAATACTCATTCAA
Bacillus licheniformis DSM 13 BLi03002 -43 6.9 ATGAATGAGTATTCATTCAT
Anoxybacillus flavithermus WK1 Aflv_0565 -44 6.9 ATGAATGATTATTCATTCAT
Geobacillus kaustophilus HTA426 GK2689 -60 6.1 ATGAATGATGGTTCATTCAT
Bacillus cereus ATCC 14579 BC4525 -45 6.6 ATGAATGACTATTCATTCAG
Bacillus halodurans C-125 BH3102 -38 6.9 ATGAATGAATACTCATTCAT
Bacillus clausii KSM-K16 ABC2672 -45 6.8 ATGAATGAACATTCATTCAT
Oceanobacillus iheyensis HTE831 OB2121 -50 5.9 ATGAATGATCATTCACTCAG