Propagation of YiaJ regulog to Pectobacterium carotovorum subsp. carotovorum PC1

Reference regulog properties
Source regulog:	YiaJ - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	IclR
Regulation mode:	repressor
Biological process:	L-lyxose utilization
Effector:	Ascorbate-6-phosphate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Pectobacterium carotovorum subsp. carotovorum PC1
Orthologous TF(s)	PC1_3687
Regulated genes	1

Built upon 8 sites [see more]

Predicted regulatory interactions in *Pectobacterium carotovorum subsp. carotovorum PC1*
	Locus tag	Position	Score	Sequence
Position: -73 Score: 6.3 Sequence: ATTTGAAATGCAATTTCGCAT Locus tag: PC1_3692
	PC1_3692	-73	6.3	ATTTGAAATGCAATTTCGCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yiaK
Ortholog function: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
Escherichia coli str. K-12 substr. MG1655	b3575	-70	6.4	ATTTGAAATCAAGTTTCGCAT
Salmonella typhimurium LT2	STM3668	-82	6	ATTTGGAACTAGATTTCGCAT
Citrobacter koseri ATCC BAA-895	CKO_05033	-72	6.5	ATTTGAAATCAGATTTCGCAT
Serratia proteamaculans 568	Spro_3933	-74	6.1	ATTTGAAATGCAATTCCGCAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --