Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of LacI regulog to Pectobacterium carotovorum subsp. carotovorum PC1

Reference regulog properties
Source regulog: LacI - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Lactose utilization
Effector: Allolactose
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Pectobacterium carotovorum subsp. carotovorum PC1
Orthologous TF(s) PC1_1363
Regulated genes 1
Built upon 5 sites [see more]
Predicted regulatory interactions in Pectobacterium carotovorum subsp. carotovorum PC1
Locus tag Position Score Sequence
Position: -70
Score: 7.4
Sequence: AATTGTGAGCGGATAACAATT
Locus tag: PC1_1362
PC1_1362 -70 7.4 AATTGTGAGCGGATAACAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: lacZ
Ortholog function: Beta-galactosidase (EC 3.2.1.23)
Escherichia coli str. K-12 substr. MG1655 b0344 -38 7.4 AATTGTGAGCGGATAACAATT
Citrobacter koseri ATCC BAA-895 CKO_02825 -38 7 AATTGTGAGCGAATAACAAAC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_pKPN3p05871 -37 7.2 AAATGTGAGCGGATAACAATT
Enterobacter sp. 638 Ent638_0928 -29 6.3 AATTGTGAGCGCTTCGCAAAG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1490 -73 7.4 AATTGTGAGCGGATAACAATT