Propagation of SdaR regulog to Klebsiella variicola At-22

Reference regulog properties
Source regulog:	SdaR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	SdaR
Regulation mode:	activator
Biological process:	Glucarate utilization; Galactarate utilization
Effector:	Glycerate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Klebsiella variicola At-22
Orthologous TF(s)	Kvar_4204
Regulated genes	4

Built upon 31 sites [see more]

Predicted regulatory interactions in *Klebsiella variicola At-22*
	Locus tag	Position	Score	Sequence
Position: -221 Score: 4.6 Sequence: TTTCAGGCATTCGCCACAAA Locus tag: Kvar_0923
	Kvar_0923	-221	4.6	TTTCAGGCATTCGCCACAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: gudP
Ortholog function: D-glucarate permease, MFS family
Escherichia coli str. K-12 substr. MG1655	b2789	-385	4.7	TTTCAGGCAAATGCCAGTAA
Salmonella typhimurium LT2	STM2962	-376	5.5	CTTTGTGCATATGCCCGCAA
Citrobacter koseri ATCC BAA-895	CKO_04143	-388	4.9	CATCAGGCATTTGCCCTAAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_03132	-376	4.4	CTTTAGGCAAACGCCACAAT
		-221	4.6	TTTCAGGCATTCGCCACAAA
Enterobacter sp. 638	Ent638_3242	-240	4.9	CGTTGTGCTTATGCCTCAAA
Erwinia carotovora subsp. atroseptica SCRI1043	ECA3577	-440	4.2	CATTATGCAATTGACCTAAG
		-264	4.6	TATAGGGCAAGTGCACCAAC

Position: -71 Score: 5.7 Sequence: CTTCGGGCATATGCACAATG Locus tag: Kvar_4204
	Kvar_4204	-71	5.7	CTTCGGGCATATGCACAATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: sdaR
Ortholog function: Glycerate-responsive transcriptional regulator for hexarate utilization, SdaR family
Escherichia coli str. K-12 substr. MG1655	b0162	-69	5.3	CTTTAGGCATTTGCACAATG
Salmonella typhimurium LT2	STM0210	-71	5.8	TTTTGTGCATTTGCACAATG
Citrobacter koseri ATCC BAA-895	CKO_03205	-17	5.1	GTTTGTGCAGATGCACAATG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_00177	-17	5.4	CTTAGTGCAAATGCACAATG
Enterobacter sp. 638	Ent638_0702	-71	5.3	CTTTGTGCATTCGCACAATG
Erwinia carotovora subsp. atroseptica SCRI1043	ECA3300	-80	4.3	CTTTGTTAATTTGCACAATG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --