Propagation of SoxR regulog to Klebsiella variicola At-22
| Source regulog: | SoxR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/Gamma |
| Propagated regulon: | |
| Target genome | Klebsiella variicola At-22 |
| Orthologous TF(s) | Kvar_4783 |
| Regulated genes | 3 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -59
Score: 6.3 Sequence: ATCTCAACTTAACTTGAGGT
Locus tag: Kvar_2443
|
||||
| Kvar_2443 | -59 | 6.3 | ATCTCAACTTAACTTGAGGT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: PF00903 | ||||
| Ortholog function: Glyoxalase/bleomycin resistance protein/dioxygenase | ||||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_01861 | -59 | 6.9 | ATCTCAAGTTAACTTGAGGT |
| Enterobacter sp. 638 | Ent638_2697 | -64 | 6.3 | ACCTCAAGTTAACTTTAGCT |
|
Position: -30
Score: 7.4 Sequence: TCCTCAAGTTAACTTGAGGT
Locus tag: Kvar_4783
|
||||
| Kvar_4783 | -30 | 7.4 | TCCTCAAGTTAACTTGAGGT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: soxR | ||||
| Ortholog function: Redox-sensitive transcriptional activator, MerR family | ||||
| Escherichia coli str. K-12 substr. MG1655 | b4063 | -30 | 7.4 | TCCTCAAGTTAACTTGAGGT |
| Salmonella typhimurium LT2 | STM4266 | -30 | 7.4 | TCCTCAAGTTAACTTGAGGT |
| Citrobacter koseri ATCC BAA-895 | CKO_03827 | -30 | 7.4 | TCCTCAAGTTAACTTGAGGT |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04463 | -57 | 7.4 | TCCTCAAGTTAACTTGAGGT |
| Enterobacter sp. 638 | Ent638_0267 | -31 | 7.4 | TCCTCAAGTTAACTTGAGGT |
| Erwinia amylovora ATCC 49946 | EAM_0317 | -30 | 7.1 | TCCTCAAGTTTACTTGAGGT |
|
Position: -74
Score: 7.4 Sequence: ACCTCAAGTTAACTTGAGGA
Locus tag: Kvar_4784
|
||||
| Kvar_4784 | -74 | 7.4 | ACCTCAAGTTAACTTGAGGA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: soxS | ||||
| Ortholog function: Transcriptional activator of superoxide response regulon, AraC family | ||||
| Escherichia coli str. K-12 substr. MG1655 | b4062 | -75 | 7.4 | ACCTCAAGTTAACTTGAGGA |
| Salmonella typhimurium LT2 | STM4265 | -76 | 7.4 | ACCTCAAGTTAACTTGAGGA |
| Citrobacter koseri ATCC BAA-895 | CKO_03828 | -76 | 7.4 | ACCTCAAGTTAACTTGAGGA |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04462 | -74 | 7.4 | ACCTCAAGTTAACTTGAGGA |
| Enterobacter sp. 638 | Ent638_0266 | -87 | 7.4 | ACCTCAAGTTAACTTGAGGA |
| Erwinia amylovora ATCC 49946 | EAM_0316 | -92 | 7.1 | ACCTCAAGTAAACTTGAGGA |