Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Crp regulog to Escherichia coli SE11

Reference regulog properties
Source regulog: Crp - Enterobacteriales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Escherichia coli SE11
Orthologous TF(s) ECSE_3619
Regulated genes 269
Built upon 2301 sites [see more]
Predicted regulatory interactions in Escherichia coli SE11
Locus tag Position Score Sequence
Position: -83
Score: 3.8
Sequence: TTTATTGACTTAGGTCACTAAA
Locus tag: ECSE_0001
ECSE_0001 -83 3.8 TTTATTGACTTAGGTCACTAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: thrL
Ortholog function: Thr operon leader peptide
Escherichia coli str. K-12 substr. MG1655 b0001 -83 3.8 TTTATTGACTTAGGTCACTAAA
Salmonella typhimurium LT2 STM0001 -103 4.2 GAATGTGATCAATTTAAAAATT
Position: -337
Score: 5.1
Sequence: TTCTGTGATTGTTATCACATTT
Position: -255
Score: 3.8
Sequence: TGTTGTGTTGTGAGTAAAAAAA
Position: -215
Score: 3.8
Sequence: ATTGGTGATCCATAAAGCAATA
Position: -158
Score: 4
Sequence: ATTGGTGAGGAACTTAACAATA
Locus tag: ECSE_0042
ECSE_0042 -337 5.1 TTCTGTGATTGTTATCACATTT
-255 3.8 TGTTGTGTTGTGAGTAAAAAAA
-215 3.8 ATTGGTGATCCATAAAGCAATA
-158 4 ATTGGTGAGGAACTTAACAATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: fixA
Ortholog function: electron transfer flavoprotein, beta subunit
Escherichia coli str. K-12 substr. MG1655 b0041 -215 4.1 ATTGGTGATCCATAAAACAATA
-158 4 ATTGGTGAGGAACTTAACAATA
Salmonella typhimurium LT2 STM0075 -281 3.8 ATTTTTGCTTTATTTATCAATT
-196 3.7 AATATTGAAAATTTTCATATTT
-157 4 ATTGGTGAGGTGCGTAACACTA
Citrobacter koseri ATCC BAA-895 CKO_03341 -179 4 ATTGGTGATCCATCAAACAATA
-122 4.4 ATTAGTGAGATGCTTAACAATA
Edwardsiella tarda EIB202 ETAE_2666 -258 3.7 ATTGGTGATCTATGTATTATTT
Proteus mirabilis HI4320 PMI2653 -216 4.3 ATTGTTGATCCAGATAACAATA
-157 4.3 ATTGGTGATGTATTTAGCAATA
-98 4 ATTGGTGATCTAGATTTAATTT
Position: -131
Score: 3.9
Sequence: TTATTTGCACGGCGTCACACTT
Locus tag: ECSE_0063
ECSE_0063 -131 3.9 TTATTTGCACGGCGTCACACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: araB
Ortholog function: L-ribulokinase
Escherichia coli str. K-12 substr. MG1655 b0063 -131 3.9 TTATTTGCACGGCGTCACACTT
Salmonella typhimurium LT2 STM0103 -131 3.8 ATATTTGCACAGCGTCACACTT
Citrobacter koseri ATCC BAA-895 CKO_03319 -132 3.9 ATATTTGCACGGCGTCACACTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00062 -130 3.9 ATATTTGCACGGCGTCACACTT
Enterobacter sp. 638 Ent638_0610 -130 3.8 TTATTTGCACAGCGTCACACTT
Position: -229
Score: 4.4
Sequence: AAGTGTGACGCCGTGCAAATAA
Locus tag: ECSE_0064
ECSE_0064 -229 4.4 AAGTGTGACGCCGTGCAAATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: araC
Ortholog function: DNA-binding transcriptional dual regulator
Escherichia coli str. K-12 substr. MG1655 b0064 -229 4.4 AAGTGTGACGCCGTGCAAATAA
Salmonella typhimurium LT2 STM0104 -231 4.5 AAGTGTGACGCTGTGCAAATAT
Citrobacter koseri ATCC BAA-895 CKO_03318 -230 4.4 AAGTGTGACGCCGTGCAAATAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00063 -229 4.4 AAGTGTGACGCCGTGCAAATAT
Enterobacter sp. 638 Ent638_0611 -228 4.4 AAGTGTGACGCTGTGCAAATAA
Position: -145
Score: 3.2
Sequence: CTTCGTAACGCCTCGCAAATTT
Locus tag: ECSE_0108
ECSE_0108 -145 3.2 CTTCGTAACGCCTCGCAAATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ppdD
Ortholog function: predicted major pilin subunit
Escherichia coli str. K-12 substr. MG1655 b0108 -145 3.2 CTTCGTAACGCCTCGCAAATTT
Citrobacter koseri ATCC BAA-895 CKO_03268 -146 3.4 TTTTTCGAGCGGCCTCGCAAAC
Yersinia pestis KIM y0761 -123 3.8 TTACGTTATTGCAATAACCTAA
Proteus mirabilis HI4320 PMI2049 -146 4.3 TAATGCGAACTTGCTCTCAATA
Position: -281
Score: 3.3
Sequence: TTAATTGAATTAAAAAACACAA
Position: -179
Score: 3.3
Sequence: ATTTGTGCATAGTTACAACTTT
Position: -156
Score: 3.7
Sequence: AAACGTTATATATGTCAAGTTG
Position: -139
Score: 3.5
Sequence: AGTTGTTAAAATGTGCACAGTT
Position: -131
Score: 3.8
Sequence: AAATGTGCACAGTTTCATGATT
Position: -119
Score: 3.5
Sequence: TTTCATGATTTCAATCAAAACC
Locus tag: ECSE_0113
ECSE_0113 -281 3.3 TTAATTGAATTAAAAAACACAA
-179 3.3 ATTTGTGCATAGTTACAACTTT
-156 3.7 AAACGTTATATATGTCAAGTTG
-139 3.5 AGTTGTTAAAATGTGCACAGTT
-131 3.8 AAATGTGCACAGTTTCATGATT
-119 3.5 TTTCATGATTTCAATCAAAACC
Supported by regulated orthologs from reference regulons
Ortholog gene name: pdhR
Ortholog function: Transcriptional repressor for pyruvate dehydrogenase complex
Escherichia coli str. K-12 substr. MG1655 b0113 -156 3.7 AAACGTTATATATGTCAAGTTG
-131 3.8 AAATGTGCACAGTTTCATGATT
Salmonella typhimurium LT2 STM0151 -157 3.5 AAACATGATTTCTGTAAAATTG
-120 3.2 TTTACTGATTTCAATCAAAACC
-79 3 CTTATTAAGCTTTCTCACGAAA
-54 3.4 TAATGGGACAGGTTCCAGATAA
Citrobacter koseri ATCC BAA-895 CKO_03260 -180 3.2 ATTTGTGCATAGTTACATCTTT
-157 3.1 AAACGTTATTTCTGTAATCTTG
-148 3.3 TTCTGTAATCTTGTTAAAATGT
-120 3.2 TTTACTGATTTCAATCAAAACC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00117 -155 3.2 AAATGTTATTTCTGTAAGGTTG
-118 3.2 TTTACTGATTTCAATCAAAACC
Enterobacter sp. 638 Ent638_0659 -120 3.2 TTTACTGATTTCAATCAAAACC
-77 3.1 TATTGTATTTTCTGGCGAAAAT
-68 3 TTTAGCGATACGAATATGAAAT
Erwinia amylovora ATCC 49946 EAM_0746 -198 3.3 TAAAGCGATCGGATTTAACAAT
Yersinia pestis KIM y0766 -151 4.2 AAATGTGCTGGGTTTCATGATT
-139 3.3 TTTCATGATTTCGGTCAAGGTC
-74 3.4 TTTTGAAATTGGTATTACCAAT
Serratia proteamaculans 568 Spro_4012 -132 3.1 AAATGTGCGGGTAACCTGATTT
-56 3.4 TTTTGAAATTGGTATTACCAAT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3790 -120 3.7 ATTGGTGATTTAGCTCAAGGTC
-55 3.4 TTTTGAAATTGGTATTACCAAT
Edwardsiella tarda EIB202 ETAE_0658 -143 3.2 TTTCATGATTTACATCAATAGT
Proteus mirabilis HI4320 PMI2047 -218 3.1 TGTTTTTAATCTTTTCTAATAA
-199 4.4 TAATGCGATCTAGTTATCAAAT
-181 4.2 AAATTTGATGAATTTATCAAAT
-158 3 ATTTGTTAAAATTTGCAGGTTT
-138 3.9 TTTTATGATTTCGCTCAACAAC
-95 3.1 CTTTGTTACTTTATTATCCATT
-89 3.1 TACTTTATTATCCATTACATTA
Position: -1
Score: 3.4
Sequence: AATGGCTATCGAAATCAAAGTA
Locus tag: ECSE_0115
ECSE_0115 -1 3.4 AATGGCTATCGAAATCAAAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: aceF
Ortholog function: Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
Escherichia coli str. K-12 substr. MG1655 b0115 -156 3.7 AAACGTTATATATGTCAAGTTG
-131 3.8 AAATGTGCACAGTTTCATGATT
Salmonella typhimurium LT2 STM0153 -157 3.5 AAACATGATTTCTGTAAAATTG
-120 3.2 TTTACTGATTTCAATCAAAACC
-79 3 CTTATTAAGCTTTCTCACGAAA
-54 3.4 TAATGGGACAGGTTCCAGATAA
Citrobacter koseri ATCC BAA-895 CKO_03258 -180 3.2 ATTTGTGCATAGTTACATCTTT
-157 3.1 AAACGTTATTTCTGTAATCTTG
-148 3.3 TTCTGTAATCTTGTTAAAATGT
-120 3.2 TTTACTGATTTCAATCAAAACC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00119 -155 3.2 AAATGTTATTTCTGTAAGGTTG
-118 3.2 TTTACTGATTTCAATCAAAACC
Enterobacter sp. 638 Ent638_0661 -120 3.2 TTTACTGATTTCAATCAAAACC
-77 3.1 TATTGTATTTTCTGGCGAAAAT
-68 3 TTTAGCGATACGAATATGAAAT
Erwinia amylovora ATCC 49946 EAM_0748 -198 3.3 TAAAGCGATCGGATTTAACAAT
Yersinia pestis KIM y0768 -151 4.2 AAATGTGCTGGGTTTCATGATT
-139 3.3 TTTCATGATTTCGGTCAAGGTC
-74 3.4 TTTTGAAATTGGTATTACCAAT
Serratia proteamaculans 568 Spro_4010 -132 3.1 AAATGTGCGGGTAACCTGATTT
-56 3.4 TTTTGAAATTGGTATTACCAAT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3788 -120 3.7 ATTGGTGATTTAGCTCAAGGTC
-55 3.4 TTTTGAAATTGGTATTACCAAT
Edwardsiella tarda EIB202 ETAE_0660 -143 3.2 TTTCATGATTTACATCAATAGT
Proteus mirabilis HI4320 PMI2045 -218 3.1 TGTTTTTAATCTTTTCTAATAA
-199 4.4 TAATGCGATCTAGTTATCAAAT
-181 4.2 AAATTTGATGAATTTATCAAAT
-158 3 ATTTGTTAAAATTTGCAGGTTT
-138 3.9 TTTTATGATTTCGCTCAACAAC
-95 3.1 CTTTGTTACTTTATTATCCATT
-89 3.1 TACTTTATTATCCATTACATTA
Position: -224
Score: 3.3
Sequence: AATTGTTAACAATTTTGTAAAA
Locus tag: ECSE_0116
ECSE_0116 -224 3.3 AATTGTTAACAATTTTGTAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: lpdA
Ortholog function: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
Escherichia coli str. K-12 substr. MG1655 b0116 -224 3.3 AATTGTTAACAATTTTGTAAAA
Salmonella typhimurium LT2 STM0154 -153 3.5 GTTTGTGAGGTTATTAGCGAAA
Citrobacter koseri ATCC BAA-895 CKO_03256 -95 3.3 AATTGTTAACAATTTTGTAAAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00120 -105 3.3 AATTGTTAACAATTTTGTAAAA
Yersinia pestis KIM y0769 -253 3.3 ATTGGTGATCTTGTTATTACTG
Serratia proteamaculans 568 Spro_4009 -246 3.6 TATGGTGATGTAATGAAAAAAG
Proteus mirabilis HI4320 PMI2044 -133 3.4 GGTTGTGAGATCTGTCATGTTA
Photorhabdus luminescens subsp. laumondii TTO1 plu3621 -131 3.9 TGTTGCGAGTTCTGTCACGTTA
Position: -144
Score: 3.9
Sequence: TTTTGTAAACAGATTAACACAT
Locus tag: ECSE_0118
ECSE_0118 -144 3.9 TTTTGTAAACAGATTAACACAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: acnB
Ortholog function: Aconitate hydratase 2 (EC 4.2.1.3)
Escherichia coli str. K-12 substr. MG1655 b0118 -144 3.5 TTTTGTAAACAGATTAACACCT
Salmonella typhimurium LT2 STM0158 -157 3.9 TTTTGTAAACAGATTAACACTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00124 -260 3.5 TTTTGTAAACAGATTAACACCT
Yersinia pestis KIM y0771 -276 4.3 TTATGTGAACGAATTAACACTG
Serratia proteamaculans 568 Spro_4008 -192 3.9 TTATGTGAACGAATTAACAACC
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3778 -163 4.3 TTATGTGAACGAATTAACAATC
Proteus mirabilis HI4320 PMI2040 -177 4.5 TTATGTGAACGAATTAACATAG
Photorhabdus luminescens subsp. laumondii TTO1 plu3619 -261 3.6 TTCTGTGAACGAATTAACATCG
Position: -135
Score: 5.3
Sequence: ATGTGTGATCGTCATCACAATT
Locus tag: ECSE_0125
ECSE_0125 -135 5.3 ATGTGTGATCGTCATCACAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: hpt
Ortholog function: hypoxanthine phosphoribosyltransferase
Escherichia coli str. K-12 substr. MG1655 b0125 -147 5.3 ATGTGTGATCGTCATCACAATT
Salmonella typhimurium LT2 STM0170 -147 5.3 ATGTGTGATCGTCATCACAAAA
Citrobacter koseri ATCC BAA-895 CKO_03242 -135 5.3 AAGTGTGATCGTCATCACAAAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00133 -134 5.4 AAGTGTGATCGGAATCACAAAT
Enterobacter sp. 638 Ent638_0673 -180 3.6 AATTTTGATAGCAATTAATTAT
-148 5.4 AAGTGTGATCGGAATCACAAAT
Proteus mirabilis HI4320 PMI0160 -154 3.6 TACTGTAATAAGTAACAAAATT
Photorhabdus luminescens subsp. laumondii TTO1 plu0860 -144 4 AATTCTGATATGCTTTGCAAAA
Position: -176
Score: 3.6
Sequence: TAATTCGCTGTATTTCGCCTTT
Locus tag: ECSE_0338
ECSE_0338 -176 3.6 TAATTCGCTGTATTTCGCCTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ycdZ
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b1036 -52 4 AAATGTGTGCTCGATCTCATTC
-50 3.7 ATGTGTGCTCGATCTCATTCAT
Citrobacter koseri ATCC BAA-895 CKO_02033 -40 3.9 AAATGTGTGCGTGATCTCATTC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01059 -52 4.1 TACTGTGTTTTAGATCGCATTC
Serratia proteamaculans 568 Spro_3290 -125 4.2 TTTTGTGACAAATTCCACATCT
-96 3.6 TATCTTGTTTCTCATTACATAT
-73 4.6 TTATGTGAAATACATCACATGA
Edwardsiella tarda EIB202 ETAE_2360 -124 4.3 AAGTGTGATTGATGTCACTTTG
-72 3.6 CGGTGTGATGTCCATCAATGAA
Proteus mirabilis HI4320 PMI3124 -240 3.7 ATTAATAATATATATCAAACAA
Position: -107
Score: 3.7
Sequence: ATATGCGTTTCAGTTAACGTTT
Locus tag: ECSE_0355
ECSE_0355 -107 3.7 ATATGCGTTTCAGTTAACGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: prpR
Ortholog function: Propionate catabolism operon regulatory protein PrpR
Escherichia coli str. K-12 substr. MG1655 b0330 -107 3.7 ATATGCGTTTCAGTTAACGTTT
Salmonella typhimurium LT2 STM0367 -89 3.5 TTTCATGAAACGAATCACCCTG
Citrobacter koseri ATCC BAA-895 CKO_02831 -179 3.4 AATTTTGTTTTTTCTTATAATT
Photorhabdus luminescens subsp. laumondii TTO1 plu3543 -225 4 ATATATGATTGTTTTTAAATTA
Position: -153
Score: 3.7
Sequence: AAACGTTAACTGAAACGCATAT
Locus tag: ECSE_0356
ECSE_0356 -153 3.7 AAACGTTAACTGAAACGCATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: prpB
Ortholog function: Methylisocitrate lyase (EC 4.1.3.30)
Escherichia coli str. K-12 substr. MG1655 b0331 -153 3.7 AAACGTTAACTGAAACGCATAT
Salmonella typhimurium LT2 STM0368 -197 3.5 CAGGGTGATTCGTTTCATGAAA
Photorhabdus luminescens subsp. laumondii TTO1 plu3542 -129 3.6 TAATTTAAAAACAATCATATAT
Position: -110
Score: 4.7
Sequence: TAATGTGAGTTAGCTCACTCAT
Locus tag: ECSE_0369
ECSE_0369 -110 4.7 TAATGTGAGTTAGCTCACTCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: lacZ
Ortholog function: beta-D-galactosidase
Escherichia coli str. K-12 substr. MG1655 b0344 -110 4.7 TAATGTGAGTTAGCTCACTCAT
Citrobacter koseri ATCC BAA-895 CKO_02825 -110 4.4 TTGTGTGAGTCAGTTCACTCAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_pKPN3p05871 -109 4.6 TAATGTGAGTCAGCTCACTCAT
Enterobacter sp. 638 Ent638_0928 -100 4.4 TTTTGTGATCGACTTCGCTTTG
Erwinia amylovora ATCC 49946 EAM_0926 -94 3.8 TGTTGCGATAGCCATCACATCC
Yersinia pestis KIM y1817 -168 4 ACATGTGCGACAGATCACATTC
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1490 -149 4.1 CTTTGTGATCGCTTCCACTTTA
-92 4.5 ATATGTTATGGAAAACACAAAT
Position: -250
Score: 3.7
Sequence: TTTTGTTACTCCGCTTACATCA
Position: -129
Score: 3.9
Sequence: AACTGTGAAACGAAACATATTT
Locus tag: ECSE_0433
ECSE_0433 -250 3.7 TTTTGTTACTCCGCTTACATCA
-129 3.9 AACTGTGAAACGAAACATATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: tsx
Ortholog function: Nucleoside-specific channel-forming protein Tsx precursor
Escherichia coli str. K-12 substr. MG1655 b0411 -250 3.7 TTTTGTTACTCTGCTTACATCA
-129 3.9 AACTGTGAAACGAAACATATTT
Salmonella typhimurium LT2 STM0413 -129 4 ATATGTGAAACAAGACATATTT
Citrobacter koseri ATCC BAA-895 CKO_02750 -131 3.7 ATCTGTGAAACAAGACATATTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00363 -131 3.8 TTATGTGAAACAACACGTATTT
Enterobacter sp. 638 Ent638_0879 -124 4.1 ATATGTGAAACAACACATATTT
Erwinia amylovora ATCC 49946 EAM_2589 -218 5.3 ATTTGTGATAAAAATCACACTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3796 -172 5.5 TTATGTGATTAAAATCACATAA
Edwardsiella tarda EIB202 ETAE_2935 -245 4.6 TAATTTGATGAGAATCTCAATT
Position: -138
Score: 3.9
Sequence: AAGTGTGGCACACATCACGCAT
Locus tag: ECSE_0478
ECSE_0478 -138 3.9 AAGTGTGGCACACATCACGCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: tesB
Ortholog function: Acyl-CoA thioesterase II (EC 3.1.2.-)
Escherichia coli str. K-12 substr. MG1655 b0452 -138 3.9 AAGTGTGGCACACATCACGCAT
Citrobacter koseri ATCC BAA-895 CKO_02706 -135 3.9 AAGTGTGGCATATCTCACTTAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00415 -139 3.8 AAGTGTGGCACAGATCTCAGAT
Enterobacter sp. 638 Ent638_0920 -131 4 AAGTGTGGCACATATCACTTAT
Yersinia pestis KIM y1043 -153 3.6 TAGCGTGCTAATTATAGCATAA
Serratia proteamaculans 568 Spro_1111 -54 3.6 TGCCGTGATATTCCGCACACTG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1162 -154 3.7 TAGTATGATTCAATAAACACAA
Position: -101
Score: 4.3
Sequence: ATGCGTGATGTGTGCCACACTT
Locus tag: ECSE_0479
ECSE_0479 -101 4.3 ATGCGTGATGTGTGCCACACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ybaY
Ortholog function: Glycoprotein-polysaccharide metabolism
Escherichia coli str. K-12 substr. MG1655 b0453 -101 4.3 ATGCGTGATGTGTGCCACACTT
Salmonella typhimurium LT2 STM0465 -100 3.9 ATGAGTGACATGTGCCACACTT
Citrobacter koseri ATCC BAA-895 CKO_02705 -102 4 ATAAGTGAGATATGCCACACTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00416 -99 3.8 ATCTGAGATCTGTGCCACACTT
Enterobacter sp. 638 Ent638_0921 -96 4.3 ATAAGTGATATGTGCCACACTT
Position: -97
Score: 4.8
Sequence: CTATGTGATCTTTATCACACAG
Locus tag: ECSE_0484
ECSE_0484 -97 4.8 CTATGTGATCTTTATCACACAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: maa
Ortholog function: maltose O-acetyltransferase
Escherichia coli str. K-12 substr. MG1655 b0459 -97 4.8 CTATGTGATCTTTATCACACAG
Salmonella typhimurium LT2 STM0472 -97 4.7 AACAGTGATATAGATCACATAG
Citrobacter koseri ATCC BAA-895 CKO_02692 -101 4.6 TCTCGTGATTTAGATCACATCA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00440 -100 4.7 CTTTGTGATAGACATCACATCA
Enterobacter sp. 638 Ent638_0939 -98 4.3 TGCTGTGACTCTGATCACATCA
Position: -105
Score: 4.7
Sequence: CTGTGTGATATTCATCACCTTA
Locus tag: ECSE_0543
ECSE_0543 -105 4.7 CTGTGTGATATTCATCACCTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: fdrA
Ortholog function: membrane protein FdrA
Escherichia coli str. K-12 substr. MG1655 b0518 -213 3.8 TTATTTGATAATCCGCTCACTT
-105 4.7 CTGTGTGATATTCATCACCTTA
Salmonella typhimurium LT2 STM0529 -120 4.4 TGATGTGACGTTAATCACTCTA
Proteus mirabilis HI4320 PMI2202 -191 4.2 AACTGTGACTTTAATCACTCTA
Position: -20
Score: 3.2
Sequence: GTTTGTCATCAGTCTCTAATAT
Locus tag: ECSE_0648
ECSE_0648 -20 3.2 GTTTGTCATCAGTCTCTAATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: entD
Ortholog function: 4'-phosphopantetheinyl transferase (EC 2.7.8.-) [enterobactin] siderophore
Escherichia coli str. K-12 substr. MG1655 b0583 -36 3.2 AGTTGCAATTCGTGGCAAAAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00601 -239 3.4 TAGCGTGACTTTTTTAATTAAT
Enterobacter sp. 638 Ent638_1115 -228 3.6 TATTTTGTTTCAGGACAAATTT
Position: -36
Score: 3.2
Sequence: AGTTGCAATTCGTGGCAAAAAT
Locus tag: ECSE_0649
ECSE_0649 -36 3.2 AGTTGCAATTCGTGGCAAAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: fepA
Ortholog function: iron-enterobactin outer membrane transporter
Escherichia coli str. K-12 substr. MG1655 b0584 -36 3.2 AGTTGCAATTCGTGGCAAAAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00602 -239 3.4 TAGCGTGACTTTTTTAATTAAT
Enterobacter sp. 638 Ent638_1116 -228 3.6 TATTTTGTTTCAGGACAAATTT
Position: -140
Score: 3.8
Sequence: GAATGTGACGCAAATCACTTCA
Locus tag: ECSE_0678
ECSE_0678 -140 3.8 GAATGTGACGCAAATCACTTCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: rnk
Ortholog function: Regulator of nucleoside diphosphate kinase
Escherichia coli str. K-12 substr. MG1655 b0610 -140 3.8 GAATGTGACGCAAATCACTTCA
Salmonella typhimurium LT2 STM0616 -141 3.8 GAATGTGAACTAAATCACTTCA
Citrobacter koseri ATCC BAA-895 CKO_02549 -141 3.9 GAATGTGAGCTAAATCACTTCA
Enterobacter sp. 638 Ent638_1148 -187 4.1 AAATCTGAGAACGATCACGTTT
-140 3.8 GAATGTGACATTCATCACTTCA
Serratia proteamaculans 568 Spro_4382 -170 3.7 CTTCGTGATCGGGATCTCTTTC
-67 3.8 TTTTGTGCTGTTTTTCCGAATT
Edwardsiella tarda EIB202 ETAE_0492 -145 4.4 ATTTGTGAGCCAGCTCTCTTTT
Photorhabdus luminescens subsp. laumondii TTO1 plu4046 -127 3.7 GTTCGTGATCATGATCTCTTTA
Position: -114
Score: 4
Sequence: TAACGCGACTTTTATCACTTTT
Locus tag: ECSE_0691
ECSE_0691 -114 4 TAACGCGACTTTTATCACTTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cspE
Ortholog function: cold shock protein E
Escherichia coli str. K-12 substr. MG1655 b0623 -114 4 TAACGCGACTTTTATCACTTTT
Salmonella typhimurium LT2 STM0629 -114 4.3 TAACGCGATATTTATCACTTTT
Citrobacter koseri ATCC BAA-895 CKO_02534 -21 4.3 TAACGCGATATTTATCACTTTT
Enterobacter sp. 638 Ent638_1159 -114 3.8 TAACGCGACTTTTGTCACTTTT
Erwinia amylovora ATCC 49946 EAM_1116 -113 3.6 AAAAACGATATTTATCACTTTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1294 -113 3.9 TTTAGCGACTTTTATCACTTTT
Position: -95
Score: 3.6
Sequence: AAGTGTAATTTCCGTCCCCATA
Locus tag: ECSE_0698
ECSE_0698 -95 3.6 AAGTGTAATTTCCGTCCCCATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ybeD
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b0631 -94 3.6 AAGTGTAATTTCCGTCCCCATA
Salmonella typhimurium LT2 STM0636 -93 4.2 AAGTGTGATTTTCGTCCCCATA
-35 3.9 AGTTGTTATTTTTTTTACGTAA
Citrobacter koseri ATCC BAA-895 CKO_02527 -91 4.4 AAGTGTGATTTCCATCCCCATA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00663 -97 4.4 AAGTGTGATTTCCATCCCCATA
Enterobacter sp. 638 Ent638_1166 -90 4.4 AAGTGTGATTTCCATCCCCATA
Yersinia pestis KIM y1174 -146 4.2 TATTGTGATTAATCTTATATTG
Position: -142
Score: 4.2
Sequence: ATTTGCGATACGAATTAAATTT
Locus tag: ECSE_0740
ECSE_0740 -142 4.2 ATTTGCGATACGAATTAAATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nagE
Ortholog function: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)
Escherichia coli str. K-12 substr. MG1655 b0679 -176 4.4 TTTGGTGACAAAACTCACAAAA
-142 4.2 ATTTGCGATACGAATTAAATTT
Salmonella typhimurium LT2 STM0685 -177 4.8 TTTAGTGATTATAATCACAAAA
Citrobacter koseri ATCC BAA-895 CKO_02485 -181 4.9 TTTGGTGATTCAAATCACAAAA
-147 3.6 ATTTGCGATACGAATTAATTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00700 -153 4.7 TTTGGTGATAATTATCACAAAA
-119 3.6 ATTTGCGATACGAATTAATTTT
Erwinia amylovora ATCC 49946 EAM_1148 -161 4.8 TAAGGTGACTTTAATCACATAT
Serratia proteamaculans 568 Spro_1228 -162 5.1 TTTGGTGATGTAAATCACAAAA
-44 3.9 AAATATGATAAAGCTCATTAAA
Photorhabdus luminescens subsp. laumondii TTO1 plu1318 -200 3.7 AAATTTGAACCCGTTTACTATT
-132 3.9 TATCGCTACAGTGATCACAATT
Position: -313
Score: 4.5
Sequence: TATCGTGACCTGGATCACTGTT
Locus tag: ECSE_0781
ECSE_0781 -313 4.5 TATCGTGACCTGGATCACTGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: sdhC
Ortholog function: Succinate dehydrogenase cytochrome b-556 subunit
Enterobacter sp. 638 Ent638_1222 -295 4.2 TATCGTGACTGTGATCACTGTT
Erwinia amylovora ATCC 49946 EAM_1168 -249 4.4 AAGTGTGATTTTTGTCACTGTT
-190 3.6 TAATGAGATTGTGATCCACTTA
Yersinia pestis KIM y3071 -254 4.5 AATCGTGATCCTAATCACTGTT
Serratia proteamaculans 568 Spro_1263 -253 4.3 ATCCGTGATCTAAATCACTGTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1357 -265 4.7 ATTCGTGATCTAAATCACTGTT
Edwardsiella tarda EIB202 ETAE_2588 -261 3.7 ATGCGTGACCGTTGTCACTGTT
Proteus mirabilis HI4320 PMI0565 -264 4.3 AAAAGTGATCCCTCTCACTGTT
Position: -300
Score: 3.6
Sequence: TAAATTGTTCTCGATCAAATTG
Position: -255
Score: 3.6
Sequence: TAAATTGATCACCGTCGAAAAA
Locus tag: ECSE_0793
ECSE_0793 -300 3.6 TAAATTGTTCTCGATCAAATTG
-255 3.6 TAAATTGATCACCGTCGAAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: cydA
Ortholog function: cytochrome d terminal oxidase, polypeptide subunit I
Escherichia coli str. K-12 substr. MG1655 b0733 -300 3.6 TAAATTGTTCTCGATCAAATTG
-255 3.6 TAAATTGATCACCGTCGAAAAA
Position: -78
Score: 3.8
Sequence: TAATTTATTCCATGTCACACTT
Locus tag: ECSE_0812
ECSE_0812 -78 3.8 TAATTTATTCCATGTCACACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: galE2
Ortholog function: UDP-galactose-4-epimerase
Escherichia coli str. K-12 substr. MG1655 b0759 -78 3.8 TAATTTATTCCATGTCACACTT
Salmonella typhimurium LT2 STM0776 -78 3.7 TAATTTATTACATGTCACACTT
Citrobacter koseri ATCC BAA-895 CKO_02376 -36 3.7 TAATATATTCCATGTCACACTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00773 -78 3.7 TAACTTGTGCTATGTCACACTT
-44 4.1 ATATGCTATCTTCCTCACAAAC
Yersinia pestis KIM y3043 -163 3.7 TTATTTGTCTATGCTCACAGAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1389 -72 3.7 ATTCTCGCTGTAGATCACCTTT
Edwardsiella tarda EIB202 ETAE_2564 -195 3.7 TAGTGTAAGCGATACCACAAAC
Position: -56
Score: 4.2
Sequence: TTTTGTGACGCCGACTACACTA
Locus tag: ECSE_0845
ECSE_0845 -56 4.2 TTTTGTGACGCCGACTACACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ybhP
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b0790 -56 4.2 TTTTGTGACGCCGACTACACTA
Salmonella typhimurium LT2 STM0813 -56 4 TTTTGTGACGACGACTACACTA
Citrobacter koseri ATCC BAA-895 CKO_02337 -56 4 TTTTGTGACGACGACTACACTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00818 -56 4.2 TTTTGTGACGTCTACTACACTA
Enterobacter sp. 638 Ent638_1281 -57 4.2 TTTTGTGACGCCGACTACACTT
Position: -98
Score: 3.9
Sequence: TAGTGTAGTCGGCGTCACAAAA
Locus tag: ECSE_0846
ECSE_0846 -98 3.9 TAGTGTAGTCGGCGTCACAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ybhQ
Ortholog function: putative inner membrane protein
Escherichia coli str. K-12 substr. MG1655 b0791 -98 3.9 TAGTGTAGTCGGCGTCACAAAA
Salmonella typhimurium LT2 STM0814 -98 3.8 TAGTGTAGTCGTCGTCACAAAA
Citrobacter koseri ATCC BAA-895 CKO_02336 -153 3.8 TAGTGTAGTCGTCGTCACAAAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00819 -97 3.8 TAGTGTAGTAGACGTCACAAAA
Enterobacter sp. 638 Ent638_1282 -98 3.9 AAGTGTAGTCGGCGTCACAAAA
Position: -111
Score: 4.5
Sequence: TTTTGTGACGCAGCGCATAAAT
Locus tag: ECSE_0851
ECSE_0851 -111 4.5 TTTTGTGACGCAGCGCATAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ybiH
Ortholog function: putative transcriptional regulator
Escherichia coli str. K-12 substr. MG1655 b0796 -123 4.5 TTTTGTGACGCAGCGCATAAAT
Salmonella typhimurium LT2 STM0819 -124 4.7 TTTTGTGATGCGGCGCATAAAT
Citrobacter koseri ATCC BAA-895 CKO_02331 -124 4.5 TTTTGTGACATACCGCATAAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00824 -224 3.6 AAATGAAACGGTATTCAAAAAA
-118 4.7 AATTGTTAAGCCCATCACAAAT
Enterobacter sp. 638 Ent638_1287 -126 4.4 TTTTGTGACACGGCGCATAAAA
Serratia proteamaculans 568 Spro_1330 -146 4.6 TTAAGTGACGCAGAGCACAATA
Proteus mirabilis HI4320 PMI0619 -160 3.6 AATTTTTAAATAAATCATGTTT
Position: -116
Score: 4.7
Sequence: AAATGTGATTTCGTACACATCT
Locus tag: ECSE_0876
ECSE_0876 -116 4.7 AAATGTGATTTCGTACACATCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ybiS
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b0819 -116 4.7 AAATGTGATTTCGTACACATCT
Salmonella typhimurium LT2 STM0837 -116 4.4 AAACGTGATTTCGTACACATCT
Citrobacter koseri ATCC BAA-895 CKO_02299 -202 3.8 ATATGTGACAAACCGCTTATTA
-116 4.7 AAATGTGATTTCGTACACATCT
Enterobacter sp. 638 Ent638_1310 -119 4.7 AAATGTGATTTCGTACACATCT
Position: -124
Score: 4.4
Sequence: AGATGTGTACGAAATCACATTT
Locus tag: ECSE_0877
ECSE_0877 -124 4.4 AGATGTGTACGAAATCACATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ybiT
Ortholog function: ABC transporter ATP-binding protein
Escherichia coli str. K-12 substr. MG1655 b0820 -124 4.4 AGATGTGTACGAAATCACATTT
Salmonella typhimurium LT2 STM0838 -124 4 AGATGTGTACGAAATCACGTTT
Citrobacter koseri ATCC BAA-895 CKO_02298 -148 4.4 AGATGTGTACGAAATCACATTT
Enterobacter sp. 638 Ent638_1311 -125 4.4 AGATGTGTACGAAATCACATTT
Yersinia pestis KIM y2677 -295 3.9 TATCGTTATACCCGTCATACTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3010 -41 4 TAATGCGCGCCAAATCACATTC
Edwardsiella tarda EIB202 ETAE_2518 -40 4.8 TAATGTGAACAAAATCACGTTA
Position: -180
Score: 4
Sequence: TAGCGTTAACTGCTTCAAATTT
Position: 11
Score: 3.8
Sequence: TACTGTTAAGTGGTTCAACAAT
Locus tag: ECSE_0938
ECSE_0938 -180 4 TAGCGTTAACTGCTTCAAATTT
11 3.8 TACTGTTAAGTGGTTCAACAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cspD
Ortholog function: cold shock-like protein
Escherichia coli str. K-12 substr. MG1655 b0880 -180 4 TAGCGTTAACTGCTTCAAATTT
Salmonella typhimurium LT2 STM0943 -181 4 TAGCGTTAACTGCTTCAAATTT
Citrobacter koseri ATCC BAA-895 CKO_02200 -210 3.9 ATCCGCGACATCTGTCACATTA
-181 4 TAGCGTTAACTGCTTCAAATTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00913 -270 4.2 AGAGGTTATGCTCATCACAAAT
-180 4 TAGCGTTAACTGCTTCAAATTT
Enterobacter sp. 638 Ent638_1397 -209 3.8 ATCCGCGATATCTGTCACATTC
-180 3.9 TAGCGTTAACTGCTTCAAAAAT
Serratia proteamaculans 568 Spro_1672 -205 4 TAGCGTTACCTGCTTCAAACTT
-49 3.9 TTCAGTTATTCATCTCACCTAA
Proteus mirabilis HI4320 PMI0688 -163 3.8 AAGCGTTAGCTACATCAAAGTT
Photorhabdus luminescens subsp. laumondii TTO1 plu1592 -194 4.6 TATCGTTATCTATATCAAACTT
Position: -164
Score: 4
Sequence: AAATTTGAAGCAGTTAACGCTA
Locus tag: ECSE_0939
ECSE_0939 -164 4 AAATTTGAAGCAGTTAACGCTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: clpS
Ortholog function: ATP-dependent Clp protease adaptor protein
Escherichia coli str. K-12 substr. MG1655 b0881 -164 4 AAATTTGAAGCAGTTAACGCTA
Salmonella typhimurium LT2 STM0944 -164 4 AAATTTGAAGCAGTTAACGCTA
-104 3.6 AGATGTTAGTTATCTATCAATT
Citrobacter koseri ATCC BAA-895 CKO_02199 -164 4 AAATTTGAAGCAGTTAACGCTA
-135 4.2 TAATGTGACAGATGTCGCGGAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00914 -167 4 AAATTTGAAGCAGTTAACGCTA
-77 4.3 ATTTGTGATGAGCATAACCTCT
Enterobacter sp. 638 Ent638_1398 -161 3.9 ATTTTTGAAGCAGTTAACGCTA
-132 3.8 GAATGTGACAGATATCGCGGAT
Erwinia amylovora ATCC 49946 EAM_1320 -161 4 AAATTTGAAGCAGTTAACGCTA
-132 4.5 TTTTGTGATAGAGGTCGCTATT
Serratia proteamaculans 568 Spro_1673 -176 3.6 AAGTTTGAAGCAGGTAACGCTA
Edwardsiella tarda EIB202 ETAE_2208 -164 3.8 AAGTTTGAGGCAGTTAACGCAA
-144 3.6 AATTGTGCGGCAGTGCGCTTTT
Proteus mirabilis HI4320 PMI0689 -268 3.7 TGTCTTTATTTACTTAACATTA
-148 4.1 AACTTTGATGTAGCTAACGCTT
Photorhabdus luminescens subsp. laumondii TTO1 plu1593 -170 4.3 AAGTTTGATATAGATAACGATA
Position: -29
Score: 4.2
Sequence: AAATTTGAACTTCCTCACGGTT
Locus tag: ECSE_0957
ECSE_0957 -29 4.2 AAATTTGAACTTCCTCACGGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ycaD
Ortholog function: Hypothetical MFS-type transporter protein ycaD
Escherichia coli str. K-12 substr. MG1655 b0898 -29 4.2 AAATTTGAACTTCCTCACGGTT
Salmonella typhimurium LT2 STM0968 -29 4.2 AAATTTGAACTTCCTCACGGTT
Citrobacter koseri ATCC BAA-895 CKO_02171 -29 4.2 AAATTTGAACTTCCTCACGGTT
Position: -78
Score: 3.8
Sequence: AGATATGATCTATATCAATTTC
Locus tag: ECSE_0963
ECSE_0963 -78 3.8 AGATATGATCTATATCAATTTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: focA
Ortholog function: formate transporter
Escherichia coli str. K-12 substr. MG1655 b0904 -156 3.6 TATTTTTATTTGGATAATCAAA
-78 3.8 AGATATGATCTATATCAATTTC
Salmonella typhimurium LT2 STM0974 -78 4.4 AGATATGATCTATATCAAATTC
Citrobacter koseri ATCC BAA-895 CKO_02167 -198 3.6 TATTTTTATTTGGATAATCAAA
-120 4.4 AGATATGATCTATATCAAATTC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00932 -121 3.8 AGATATGATCTATATCAATTTC
Enterobacter sp. 638 Ent638_1424 -78 3.8 AGATATGATCTATATCAATTTC
Yersinia pestis KIM y2789 -84 4 CAATATGATCCATATCAATTTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2596 -79 4.5 CAATATGATCCACATCAAATTT
Proteus mirabilis HI4320 PMI0706 -188 4 TTTTTTGATAAAATTTAAAAAA
Photorhabdus luminescens subsp. laumondii TTO1 plu1614 -88 4.7 AATTATGATCTATATCAAATTC
Position: -155
Score: 4.8
Sequence: TTGTGTGATGCAAGCCACATTT
Position: -113
Score: 3.8
Sequence: CATTGCGATGTGTGTCACTGAA
Locus tag: ECSE_0966
ECSE_0966 -155 4.8 TTGTGTGATGCAAGCCACATTT
-113 3.8 CATTGCGATGTGTGTCACTGAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: serC
Ortholog function: Phosphoserine aminotransferase (EC 2.6.1.52)
Escherichia coli str. K-12 substr. MG1655 b0907 -155 4.8 TTGTGTGATGCAAGCCACATTT
Salmonella typhimurium LT2 STM0977 -142 4.2 TTGTGTGACGCATGCCGCATTT
Citrobacter koseri ATCC BAA-895 CKO_02165 -171 4.6 TTGTGTGACGTAGCGCGCATTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00935 -145 3.7 TTGTGTGACGGCGGCCGCGTTT
Enterobacter sp. 638 Ent638_1427 -119 4.4 TTGTGTGACGGTGGACACATTT
Yersinia pestis KIM y2784 -39 3.3 TATAACGATGGCAATCTCAGTA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2594 -78 3.5 AAGTATGACGGGTATAAAAATG
Proteus mirabilis HI4320 PMI0711 -119 3.5 TATTTTTGTGTGCTACACATAA
Position: -242
Score: 4.4
Sequence: AAATATGACGGTGTTCACAAAG
Locus tag: ECSE_0988
ECSE_0988 -242 4.4 AAATATGACGGTGTTCACAAAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: ompF
Ortholog function: Outer membrane protein F precursor
Escherichia coli str. K-12 substr. MG1655 b0929 -242 4.4 AAATATGACGGTGTTCACAAAG
Position: -4
Score: 4
Sequence: AAATGTGTGCTCGATCTCATTC
Position: -2
Score: 3.7
Sequence: ATGTGTGCTCGATCTCATTCAT
Locus tag: ECSE_1098
ECSE_1098 -4 4 AAATGTGTGCTCGATCTCATTC
-2 3.7 ATGTGTGCTCGATCTCATTCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ycdZ
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b1036 -52 4 AAATGTGTGCTCGATCTCATTC
-50 3.7 ATGTGTGCTCGATCTCATTCAT
Citrobacter koseri ATCC BAA-895 CKO_02033 -40 3.9 AAATGTGTGCGTGATCTCATTC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01059 -52 4.1 TACTGTGTTTTAGATCGCATTC
Serratia proteamaculans 568 Spro_3290 -125 4.2 TTTTGTGACAAATTCCACATCT
-96 3.6 TATCTTGTTTCTCATTACATAT
-73 4.6 TTATGTGAAATACATCACATGA
Edwardsiella tarda EIB202 ETAE_2360 -124 4.3 AAGTGTGATTGATGTCACTTTG
-72 3.6 CGGTGTGATGTCCATCAATGAA
Proteus mirabilis HI4320 PMI3124 -240 3.7 ATTAATAATATATATCAAACAA
Position: -201
Score: 3.9
Sequence: TTTAGTTACATGTTTAACACTT
Position: -35
Score: 3.4
Sequence: AGGTGTGCGATCAATAAAAAAA
Locus tag: ECSE_1102
ECSE_1102 -201 3.9 TTTAGTTACATGTTTAACACTT
-35 3.4 AGGTGTGCGATCAATAAAAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: csgD
Ortholog function: DNA-binding transcriptional activator in two-component regulatory system
Escherichia coli str. K-12 substr. MG1655 b1040 -201 3.9 TTTAGTTACATGTTTAACACTT
-134 3.3 TAGTTTTATATTTTACCCATTT
Salmonella typhimurium LT2 STM1142 -202 3.4 TTTGGTTACAAGTTTAACACTT
Citrobacter koseri ATCC BAA-895 CKO_02029 -207 4.1 TTTTGTTACAAGTTTAACACTT
Position: -154
Score: 4.4
Sequence: AAACGTGATAGCCGTCAAACAA
Locus tag: ECSE_1165
ECSE_1165 -154 4.4 AAACGTGATAGCCGTCAAACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ptsG
Ortholog function: PTS system, glucose-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
Escherichia coli str. K-12 substr. MG1655 b1101 -154 4.4 AAACGTGATAGCCGTCAAACAA
Salmonella typhimurium LT2 STM1203 -155 4.4 AAACGTGATAGCCGTCAAACAA
Citrobacter koseri ATCC BAA-895 CKO_01957 -229 4.4 AAACGTGATAGCCGTCAAACAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01099 -155 4.4 AAACGTGATAGCCGTCAAACAA
Enterobacter sp. 638 Ent638_1616 -155 4.4 AAACGTGATAGCCGTCAAACAA
Erwinia amylovora ATCC 49946 EAM_1466 -162 4.6 AAACGTGATAGCCATCAAACAA
Yersinia pestis KIM y1767 -166 4.4 AAACGTGACGGCAATCAAACAT
Serratia proteamaculans 568 Spro_1914 -164 4.4 AAACGTGACTGTCATCAAACAT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1805 -162 4.6 AAACGTGATAGCAATCAAACAT
Proteus mirabilis HI4320 PMI2292 -156 4.5 AAACGTGACAGCTATCATATAT
Position: -154
Score: 3.9
Sequence: AAACTTGATTAACATCAATTTT
Locus tag: ECSE_1174
ECSE_1174 -154 3.9 AAACTTGATTAACATCAATTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ndh
Ortholog function: NADH dehydrogenase (EC 1.6.99.3)
Escherichia coli str. K-12 substr. MG1655 b1109 -154 3.9 AAACTTGATTAACATCAATTTT
Salmonella typhimurium LT2 STM1211 -154 4.1 AAACTTGATGCACATCAATTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01106 -152 4.1 AAACTTGATGCACATCAATTTT
Enterobacter sp. 638 Ent638_1624 -153 4 AAACTTGATTCATATCAATTTT
Erwinia amylovora ATCC 49946 EAM_1473 -55 3.7 TAAGGTTATTTTATTAACCTTT
Yersinia pestis KIM y1777 -152 3.8 AAAGTTGATATATATCAATTTT
Serratia proteamaculans 568 Spro_1926 -153 4.3 AAGTTTGATGTACATCAATTTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1815 -153 4 TAAATTGATATATATCAATTTT
Edwardsiella tarda EIB202 ETAE_2070 -166 4.3 TTATTTGATTTGAATCAATTTT
Proteus mirabilis HI4320 PMI0875 -157 4.6 TTTTTTGATATAAATCAACTTT
Photorhabdus luminescens subsp. laumondii TTO1 plu2821 -154 3.8 GAATTTGATGTTGTTCAATTTT
Position: -96
Score: 5.3
Sequence: AGATGTGATCTGGATCACATAC
Locus tag: ECSE_1176
ECSE_1176 -96 5.3 AGATGTGATCTGGATCACATAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: ycfQ
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b1111 -175 5.3 AGATGTGATCTGGATCACATAC
Salmonella typhimurium LT2 STM1213 -175 4.7 AGATGTGATCTACATCACACGT
Citrobacter koseri ATCC BAA-895 CKO_01943 -227 4.4 AGATGTGATCCAGGTCACACGT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01109 -227 4.8 TAATGTGATCTATGTCACACGT
Enterobacter sp. 638 Ent638_1626 -174 4.6 AGATGTGATCTGCATCACACGT
Position: -114
Score: 3.7
Sequence: ATTAATGATTGTTATAAAAAAT
Position: -87
Score: 4.8
Sequence: GTATGTGATCCAGATCACATCT
Locus tag: ECSE_1177
ECSE_1177 -114 3.7 ATTAATGATTGTTATAAAAAAT
-87 4.8 GTATGTGATCCAGATCACATCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ycfR
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b1112 -114 3.7 ATTAATGATTGTTATAAAAAAT
-87 4.8 GTATGTGATCCAGATCACATCT
Salmonella typhimurium LT2 STM1214 -88 4.7 ACGTGTGATGTAGATCACATCT
Citrobacter koseri ATCC BAA-895 CKO_01942 -113 3.8 TATAATGATCGTTATAAAAAAA
-86 4.5 ACGTGTGACCTGGATCACATCT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01110 -95 4.9 ACGTGTGACATAGATCACATTA
Enterobacter sp. 638 Ent638_1627 -91 4.7 ACGTGTGATGCAGATCACATCT
Serratia proteamaculans 568 Spro_4435 -116 3.7 TTATTTGATAAAGATTATCAAA
Position: -73
Score: 3.6
Sequence: AAAAGTGACCTGACGCAATATT
Locus tag: ECSE_1193
ECSE_1193 -73 3.6 AAAAGTGACCTGACGCAATATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: pepT
Ortholog function: peptidase T
Escherichia coli str. K-12 substr. MG1655 b1127 -73 3.6 AAAAGTGACCTGACGCAATATT
Salmonella typhimurium LT2 STM1227 -73 3.6 AAAAGTGACCTGACGCAATATT
Citrobacter koseri ATCC BAA-895 CKO_01926 -73 3.6 AAAAGTGACCTGACGCAATATT
Enterobacter sp. 638 Ent638_1640 -31 3.6 AAAAGTGACCTGACGCAATATT
Yersinia pestis KIM y1791 -27 3.7 ATATTTGATCATGATCACTTCC
Serratia proteamaculans 568 Spro_2009 -188 4.1 CGTCGTGAAGAAGATCACACAT
Position: -21
Score: 3.9
Sequence: CTGTGTTATGGAAATCTCACTA
Locus tag: ECSE_1235
ECSE_1235 -21 3.9 CTGTGTTATGGAAATCTCACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: fadR
Ortholog function: fatty acid metabolism regulator
Escherichia coli str. K-12 substr. MG1655 b1187 -21 3.9 CTGTGTTATGGAAATCTCACTA
Salmonella typhimurium LT2 STM1805 -21 3.8 CTGTGTAATGGAAATCTCACTA
Enterobacter sp. 638 Ent638_2365 -21 3.8 CTGTGTAATGGAAATCTCACTA
Yersinia pestis KIM y2177 -113 3.8 CTTTATGACTGCTTTCACCATT
Proteus mirabilis HI4320 PMI1510 -111 4.4 TTTTATGATGCCATTCACTATT
-84 3.8 ATGGTTGAGCTATATCAAAATT
Position: -235
Score: 4.4
Sequence: TATGGTGAGCTGGCTCACATCT
Locus tag: ECSE_1236
ECSE_1236 -235 4.4 TATGGTGAGCTGGCTCACATCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ycgB
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b1188 -235 4.4 TATGGTGAGCTGGCTCACATCT
Salmonella typhimurium LT2 STM1804.S -243 4.9 TATGGTGACGTGCTTCACATAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02310 -174 4 TATGGTGACTTAACTCACAGCA
Enterobacter sp. 638 Ent638_2364 -236 4.2 TATGGTGACTTACCTCACACCT
Position: -116
Score: 4.7
Sequence: AGATGTGAGCCAGCTCACCATA
Locus tag: ECSE_1237
ECSE_1237 -116 4.7 AGATGTGAGCCAGCTCACCATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: dadA
Ortholog function: D-amino acid dehydrogenase small subunit
Escherichia coli str. K-12 substr. MG1655 b1189 -116 4.7 AGATGTGAGCCAGCTCACCATA
Salmonella typhimurium LT2 STM1803 -107 4.6 ATATGTGAAGCACGTCACCATA
Citrobacter koseri ATCC BAA-895 CKO_01193 -107 4.5 AGATGTGAGGTGCGTCACCATA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02309 -106 4.1 TGCTGTGAGTTAAGTCACCATA
Enterobacter sp. 638 Ent638_2363 -107 4.3 AGGTGTGAGGTAAGTCACCATA
Serratia proteamaculans 568 Spro_2746 -113 4.6 AATTGTGAATGTTGTCACGTTT
Proteus mirabilis HI4320 PMI1509 -121 4.7 AAATGTGATTTGACTCTAAAAT
Photorhabdus luminescens subsp. laumondii TTO1 plu2561 -114 5.4 AATTGTGATCTAAATCATAAAT
Position: -105
Score: 4.5
Sequence: AATTGTGATCACGCCCGCACAT
Locus tag: ECSE_1255
ECSE_1255 -105 4.5 AATTGTGATCACGCCCGCACAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ychH
Ortholog function: membrane protein
Escherichia coli str. K-12 substr. MG1655 b1205 -105 4.5 AATTGTGATCACGCCCGCACAT
Salmonella typhimurium LT2 STM1782 -105 4.4 ATTTGTGATCGCACCCGCACTT
Citrobacter koseri ATCC BAA-895 CKO_01260 -104 4.1 AATTGTGATCGCCCACGCACTC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02241 -100 4.1 TAATGTGATCGTGGACGCACTC
Enterobacter sp. 638 Ent638_2343 -119 3.7 TGTTGTGACGAGAGTCATTAAT
-101 4 TAATGTGATCATTCACGCAACT
Erwinia amylovora ATCC 49946 EAM_1581 -97 3.9 AAATGTGATCGCTGACTCATCA
Yersinia pestis KIM y2296 -145 3.9 AGTTGTGATCGCTACCGCAACA
Serratia proteamaculans 568 Spro_1985 -117 4.2 ATTTGTGATCGCCTACGCAATC
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2185 -275 3.6 TAGCGTGATTATGAGAACGCTA
-117 3.8 ATCTGTGATCCCTCCCGCAATC
Photorhabdus luminescens subsp. laumondii TTO1 plu2065 -189 4.1 AGTTGTGATCGTGTCCGCAATG
Position: -241
Score: 5
Sequence: AAATTTGATTTGGATCACGTAA
Locus tag: ECSE_1289
ECSE_1289 -241 5 AAATTTGATTTGGATCACGTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: adhE
Ortholog function: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
Escherichia coli str. K-12 substr. MG1655 b1241 -241 5 AAATTTGATTTGGATCACGTAA
Salmonella typhimurium LT2 STM1749 -242 4.9 AATCTTGATTTAGATCACACAA
Citrobacter koseri ATCC BAA-895 CKO_01318 -242 4.9 AAATTTGATCTGGATCACGCAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02199 -237 4.7 ATACTTGATCTAAATCACGTAA
Enterobacter sp. 638 Ent638_2304 -253 4.1 TAAATTGATTCAGATCATGTTT
Erwinia amylovora ATCC 49946 EAM_1900 -223 3.9 ATTGATGATCTGCATCATCTTT
Yersinia pestis KIM y2023 -286 5.3 TTTTGTGATTTAAATCACGAAA
Serratia proteamaculans 568 Spro_2704 -278 5.1 TTTTATGATTTAAATCACAAAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2326 -315 4.5 AAGTTCGATGTTGATCACAAAA
Edwardsiella tarda EIB202 ETAE_1508 -265 5 TTTCGTGACCTTAATCACAAAA
Proteus mirabilis HI4320 PMI1486 -246 5.4 TATTGTGATGTAGATCACTTTA
-187 3.7 AAAGGAGATCTTTTTAAAATAT
Photorhabdus luminescens subsp. laumondii TTO1 plu2496 -237 3.7 TATTTTTATTAGATTAAAAATT
-138 4.6 TTATGTGATTAAGATCAATATA
Position: -257
Score: 5.1
Sequence: TTACGTGATCCAAATCAAATTT
Locus tag: ECSE_1290
ECSE_1290 -257 5.1 TTACGTGATCCAAATCAAATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ychE
Ortholog function: putative channel protein
Escherichia coli str. K-12 substr. MG1655 b1242 -257 5.1 TTACGTGATCCAAATCAAATTT
Salmonella typhimurium LT2 STM1748 -256 4.8 TTGTGTGATCTAAATCAAGATT
Citrobacter koseri ATCC BAA-895 CKO_01319 -167 5 TTGCGTGATCCAGATCAAATTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02198 -261 4.8 TTACGTGATTTAGATCAAGTAT
Enterobacter sp. 638 Ent638_2303 -256 4 AAACATGATCTGAATCAATTTA
Erwinia amylovora ATCC 49946 EAM_1899 -158 3.8 AAAGATGATGCAGATCATCAAT
Serratia proteamaculans 568 Spro_2703 -268 5.2 TTTTGTGATTTAAATCATAAAA
Proteus mirabilis HI4320 PMI1485 -290 5.3 TAAAGTGATCTACATCACAATA
Photorhabdus luminescens subsp. laumondii TTO1 plu2495 -295 4.9 TATATTGATCTTAATCACATAA
Position: -166
Score: 4.9
Sequence: AAAATTGATTTAAATCACATTA
Position: -82
Score: 3.8
Sequence: TAATGTGATCTATGTAGGATCA
Locus tag: ECSE_1305
ECSE_1305 -166 4.9 AAAATTGATTTAAATCACATTA
-82 3.8 TAATGTGATCTATGTAGGATCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ompW
Ortholog function: outer membrane protein W
Escherichia coli str. K-12 substr. MG1655 b1256 -166 4.9 AAAATTGATTTAAATCACATTA
-82 3.8 TAATGTGATCTATGTAGGATCA
Salmonella typhimurium LT2 STM1732 -82 4.2 AAATGTGATCTGTATTAGATCA
Citrobacter koseri ATCC BAA-895 CKO_01333 -82 3.9 TAATGTGATCTGTATTGGATCA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01248 -101 3.9 CATTGCGATCGGTAGCAAAAAT
-45 4 TAGTGTGATCTAAAACAGATCA
Enterobacter sp. 638 Ent638_2283 -121 3.7 AAAATTAATCTGGATCAACAAA
Yersinia pestis KIM y2044 -69 3.9 AGATGTGATCTCGATTAGATCA
Serratia proteamaculans 568 Spro_2674 -135 3.8 TTTTTTGATTCAGATCAATCCT
Edwardsiella tarda EIB202 ETAE_1528 -161 3.9 CTGATTGATGTCTATCAAATTT
Proteus mirabilis HI4320 PMI1350 -168 4.6 AAATTTGATGTGGATCAATTAT
-85 3.8 AGTTGTGATCGGCATTAGATCA
Photorhabdus luminescens subsp. laumondii TTO1 plu2478 -164 4.3 AACTTTGATTTGGATCAAGTTA
-39 3.8 TATTTTGATTGACTTTAAATCA
Position: -175
Score: 3.7
Sequence: AACTGTGACGGATTTCGCACCC
Position: -109
Score: 3.8
Sequence: AGTTGCTATACAGATCGCATAG
Locus tag: ECSE_1472
ECSE_1472 -175 3.7 AACTGTGACGGATTTCGCACCC
-109 3.8 AGTTGCTATACAGATCGCATAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: paaN
Ortholog function: Phenylacetic acid degradation protein PaaN, ring-opening aldehyde dehydrogenase (EC 1.2.1.3)
Escherichia coli str. K-12 substr. MG1655 b1387 -261 3.6 TTTCGTGAATTAATTAAAAACA
-175 3.7 AACTGTGACGGATTTCGCACCC
-109 3.8 AGTTGCTATACAGATCGCATAG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01468 -246 3.3 TTATGTGAATCACTTTGTTTAT
-177 4.4 TTTTGTGATAATCTCCGCAAAA
Serratia proteamaculans 568 Spro_3071 -277 3.8 AAATGTGAATCACGTTAACTAA
-206 4 TTTTGCGATGTTACTCACAGGT
Position: -97
Score: 4
Sequence: ATTTGTGATTTTAGTTAACCAT
Locus tag: ECSE_1473
ECSE_1473 -97 4 ATTTGTGATTTTAGTTAACCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: paaA
Ortholog function: predicted multicomponent oxygenase/reductase subunit for phenylacetic acid degradation
Escherichia coli str. K-12 substr. MG1655 b1388 -97 4.3 ATTTGTGATTTTACTTAACTAT
-76 3.6 TTGTGTAACTTTCATAAAACAA
-45 3.6 TGTTTTTAATTAATTCACGAAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01469 -197 3.8 CATTGTGATCGCGATGGCGTTA
-131 3.7 TTTTGCGGAGATTATCACAAAA
Serratia proteamaculans 568 Spro_3072 -134 3.8 ACCTGTGAGTAACATCGCAAAA
-63 3.8 TTAGTTAACGTGATTCACATTT
Position: -112
Score: 4.3
Sequence: TTTTATGAAGCCCTTCACAGAA
Locus tag: ECSE_1498
ECSE_1498 -112 4.3 TTTTATGAAGCCCTTCACAGAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: aldA
Ortholog function: aldehyde dehydrogenase A
Escherichia coli str. K-12 substr. MG1655 b1415 -112 4.3 TTTTATGAAGCCCTTCACAGAA
Citrobacter koseri ATCC BAA-895 CKO_01448 -137 4.7 TTTTATGAAGCACATCACAAAA
-91 3.9 ACATGTGATTGTTATTACTTAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01501 -137 4.4 TTTTATGAATCAGCTCACAGAA
Enterobacter sp. 638 Ent638_1953 -113 4.7 TTTTATGAGATATCTCACAAAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0118 -36 3.6 AAGTATGACGGGTATATCACTT
Position: -201
Score: 3.4
Sequence: TTGCGTGCTGTTTTCCAGAATT
Position: 24
Score: 3.4
Sequence: TTAGGTTTTTTGCATCACATCA
Locus tag: ECSE_1503
ECSE_1503 -201 3.4 TTGCGTGCTGTTTTCCAGAATT
24 3.4 TTAGGTTTTTTGCATCACATCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: trg
Ortholog function: Methyl-accepting chemotaxis protein III (ribose and galactose chemoreceptor protein)
Escherichia coli str. K-12 substr. MG1655 b1421 -201 3.4 TTGCGTGCTGTTTTCCAGAATT
Citrobacter koseri ATCC BAA-895 CKO_01456 -108 3.7 AAATGTGACAAACATTCCGATT
Enterobacter sp. 638 Ent638_1961 -110 3.5 AAGTGTGACCCACCTGGCGCTT
Position: 23
Score: 3.8
Sequence: TAAAGCTAAGCAGCTCACATTA
Locus tag: ECSE_1582
ECSE_1582 23 3.8 TAAAGCTAAGCAGCTCACATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: gadC
Ortholog function: predicted glutamate:gamma-aminobutyric acid antiporter
Escherichia coli str. K-12 substr. MG1655 b1492 -297 3.6 TTTTATAAATGCGTTCAAAATA
-158 3.3 TATTGTATTGTTTTTCAATGAA
-128 3.3 ATTCGCGTAATATCTCACGATA
Position: -297
Score: 3.6
Sequence: TTTTATAAATGCGTTCAAAATA
Locus tag: ECSE_1583
ECSE_1583 -297 3.6 TTTTATAAATGCGTTCAAAATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: gadB
Ortholog function: Glutamate decarboxylase (EC 4.1.1.15)
Escherichia coli str. K-12 substr. MG1655 b1493 -297 3.6 TTTTATAAATGCGTTCAAAATA
-158 3.3 TATTGTATTGTTTTTCAATGAA
-128 3.3 ATTCGCGTAATATCTCACGATA
Edwardsiella tarda EIB202 ETAE_2868 -186 3.7 TAGCGTTATTTTTCTCATCATT
Position: -87
Score: 3.8
Sequence: AACTGTGGCTGCCATCACAGAT
Locus tag: ECSE_1602
ECSE_1602 -87 3.8 AACTGTGGCTGCCATCACAGAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: lsrR
Ortholog function: LsrR, transcriptional repressor of lsr operon
Escherichia coli str. K-12 substr. MG1655 b1512 -87 4.1 AACTGTGGTTGCCATCACAGAT
Salmonella typhimurium LT2 STM4073 -161 3.6 AACTCTCATCCAGATCACGTTT
-92 4 TTTTGTGGCGTTAATCACGGTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03508 -75 3.7 TTTTGCCAGTCGGCTCACACTT
Enterobacter sp. 638 Ent638_3537 -122 3.4 TTTATTGATTAGGATCCAATTC
Photorhabdus luminescens subsp. laumondii TTO1 plu3142 -137 4.3 AATTGTGATCTTGGCAATATTT
Position: -94
Score: 4.9
Sequence: AAACGCGATCCAGATCACAAAT
Locus tag: ECSE_1618
ECSE_1618 -94 4.9 AAACGCGATCCAGATCACAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: sotB
Ortholog function: Probable sugar efflux transporter
Escherichia coli str. K-12 substr. MG1655 b1528 -94 4.9 AAACGCGATCCAGATCACAAAT
Salmonella typhimurium LT2 STM1522 -94 4.5 AAATGAGAAGCAGGTCACAAAA
Citrobacter koseri ATCC BAA-895 CKO_01548 -94 4.8 TAATGAGACATACATCACAAAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01628 -94 4.8 AAATGAGACGCAGATCACAAAA
Enterobacter sp. 638 Ent638_2000 -95 4.9 TTTTGAGATCTGCGTCACATAA
Position: -108
Score: 4.1
Sequence: AAATGTGCTGTTAATCACATGC
Locus tag: ECSE_1715
ECSE_1715 -108 4.1 AAATGTGCTGTTAATCACATGC
Supported by regulated orthologs from reference regulons
Ortholog gene name: mlc
Ortholog function: ROK family transcriptional regulatory protein
Escherichia coli str. K-12 substr. MG1655 b1594 -108 4.1 AAATGTGCTGTTAATCACATGC
Salmonella typhimurium LT2 STM1488 -65 3.8 AGTATTGAAGTGTTTCACCATA
Citrobacter koseri ATCC BAA-895 CKO_01593 -107 3.6 AAaTGTGcagTAaATCACAcgg
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01574 -104 3.8 AAATGTGCGGTAAATCACAAGG
Enterobacter sp. 638 Ent638_1919 -107 3.8 AAATGTGCGGTAAATCACAAGG
Erwinia amylovora ATCC 49946 EAM_1710 -143 4.9 TTATGTGCTGTAAATCACATTC
Yersinia pestis KIM y2110 -146 4.8 TTATGTGCAGCAAATCACATAA
Serratia proteamaculans 568 Spro_2283 -111 4.8 ATTTGTGCAGCAAATCACATAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2258 -226 4.4 ATATGCGCGCTAAATCACATAA
Edwardsiella tarda EIB202 ETAE_1713 -113 4.8 ATTTGTGCACTTAATCACATAA
Proteus mirabilis HI4320 PMI1292 -126 4.7 ATATGTGCTTTCCATCACGATT
Photorhabdus luminescens subsp. laumondii TTO1 plu2226 -119 4.8 TTTCGTGCTGAATATCACATAT
Position: -93
Score: 4
Sequence: TTATCTGATTTTACTCCCACTT
Locus tag: ECSE_1719
ECSE_1719 -93 4 TTATCTGATTTTACTCCCACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ydgD
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b1598 -93 4 TTATCTGATTTTACTCCCACTT
Salmonella typhimurium LT2 STM1484 -93 4 TTATCTGATTTTACTCCCACTT
Citrobacter koseri ATCC BAA-895 CKO_01604 -95 4 TTATCTGATTTTACTCCCACTT
Enterobacter sp. 638 Ent638_1914 -53 4.1 TATTTTAATAGGGTTCACTTTT
Yersinia pestis KIM y2013 -160 3.6 TTTTTTTATTTATAGCACGAAC
Position: -102
Score: 3.9
Sequence: TAGTGAGGCATAAATCACATTA
Position: -42
Score: 3.9
Sequence: AAACGTTTTATCTGTCACATAA
Locus tag: ECSE_1741
ECSE_1741 -102 3.9 TAGTGAGGCATAAATCACATTA
-42 3.9 AAACGTTTTATCTGTCACATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: malI
Ortholog function: Maltose regulon regulatory protein MalI (repressor for malXY)
Escherichia coli str. K-12 substr. MG1655 b1620 -104 3.4 TTTAGTGAGGCATAAATCACAT
-102 3.9 TAGTGAGGCATAAATCACATTA
-42 3.9 AAACGTTTTATCTGTCACATAA
Citrobacter koseri ATCC BAA-895 CKO_01626 -103 4 TAGTGCGGCGCAAATCACATTA
-56 3.9 ATAAGTGATTGATAAAACGTTT
-42 3.6 AAACGTTTTATCTGTCACGTTA
Position: -94
Score: 4.4
Sequence: TAATGTGATTTATGCCTCACTA
Locus tag: ECSE_1742
ECSE_1742 -94 4.4 TAATGTGATTTATGCCTCACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: malX
Ortholog function: PTS family enzyme IIC/enzyme IIB
Escherichia coli str. K-12 substr. MG1655 b1621 -154 4.1 TTATGTGACAGATAAAACGTTT
-94 4.4 TAATGTGATTTATGCCTCACTA
Enterobacter sp. 638 Ent638_1827 -96 4.2 GAATGTGATTCAGAGCGCACTA
Position: -80
Score: 3.8
Sequence: TTCTGCGAGATTTCTCACAAAG
Locus tag: ECSE_1785
ECSE_1785 -80 3.8 TTCTGCGAGATTTCTCACAAAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: cfa
Ortholog function: cyclopropane fatty acyl phospholipid synthase
Escherichia coli str. K-12 substr. MG1655 b1661 -80 3.8 TTCTGCGAGATTTCTCACAAAG
Citrobacter koseri ATCC BAA-895 CKO_01676 -81 4.1 TTCCGTGAGATTTCTCACAAAG
Position: -304
Score: 3.9
Sequence: TTTTGTGAATTAATTTGTATAT
Position: -56
Score: 3.6
Sequence: TTGTGTAATACTTGTAACGCTA
Locus tag: ECSE_1800
ECSE_1800 -304 3.9 TTTTGTGAATTAATTTGTATAT
-56 3.6 TTGTGTAATACTTGTAACGCTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: lpp
Ortholog function: major outer membrane lipoprotein
Escherichia coli str. K-12 substr. MG1655 b1677 -56 3.6 TTGTGTAATACTTGTAACGCTA
Salmonella typhimurium LT2 STM1377 -56 3.6 TTGTGTAATACTTGTAACGCTA
Citrobacter koseri ATCC BAA-895 CKO_01710 -56 3.6 TTGTGTAATACTTGTAACGCTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02134 -56 3.6 TTGTGTAATACTTGTAACGCTA
Enterobacter sp. 638 Ent638_1767 -56 3.6 TTGTGTAATACTTGTAACGCTA
Erwinia amylovora ATCC 49946 EAM_1656 -56 3.6 TTGTGTAATACTTGTAACGCTA
Serratia proteamaculans 568 Spro_2186 -55 3.6 TTGTGTAATACTTGTAACGCTA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1866 -56 3.6 TTGTGTAATACTTGTAACGCTA
Edwardsiella tarda EIB202 ETAE_1852 -55 3.6 TTGTGTAATACTTGTAACGCTA
Proteus mirabilis HI4320 PMI1409 -200 4.4 TTTTGTGAAATAACACGCATTT
Position: -106
Score: 4.3
Sequence: AGGTGTGACACACCTCGCACTT
Position: -64
Score: 4
Sequence: TATCGTGATGCGCATCACTTCC
Locus tag: ECSE_1829
ECSE_1829 -106 4.3 AGGTGTGACACACCTCGCACTT
-64 4 TATCGTGATGCGCATCACTTCC
Supported by regulated orthologs from reference regulons
Ortholog gene name: aroH
Ortholog function: phospho-2-dehydro-3-deoxyheptonate aldolase
Escherichia coli str. K-12 substr. MG1655 b1704 -106 4.3 AGGTGTGACACACCTCGCACTT
-64 4 TATCGTGATGCGCATCACTTCC
Salmonella typhimurium LT2 STM1347 -106 4.3 AGGTGTGACACGCCTCGCACTT
-64 4 TATCGTGATGCCCATCACTTCC
Citrobacter koseri ATCC BAA-895 CKO_01728 -115 4.3 AGGTGTGAAACGCCTCGCATTT
-64 4.3 TATTGTGATGCCCATCACTTCC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02162 -63 4 TATCGTGATGCGCATCACTTCC
Enterobacter sp. 638 Ent638_1743 -126 3.6 AGTTATGATCGCTTTCACTCTC
-62 3.6 TAAGGTGATGCCCATCACTTCC
Yersinia pestis KIM y1928 -64 4.3 TATTGTGATCGCCATCACTTCC
Serratia proteamaculans 568 Spro_2172 -135 3.9 TTTTGTGCTTTTTTTAGCGATT
-64 4.3 TATTGTGATCGCCATCACTTCC
Edwardsiella tarda EIB202 ETAE_1792 -63 4 TATCGTGATCCCCATCACTTCC
Proteus mirabilis HI4320 PMI1423 -55 3.9 TATTGTGATCTTAATCACTGGG
Photorhabdus luminescens subsp. laumondii TTO1 plu2630 -62 3.8 TATTGTAATTTCCATTATCTAT
Position: -90
Score: 3.9
Sequence: ATATAAGAGCCAGCTCACAGTT
Locus tag: ECSE_1898
ECSE_1898 -90 3.9 ATATAAGAGCCAGCTCACAGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: tcyP
Ortholog function: L-cystine uptake protein TcyP
Escherichia coli str. K-12 substr. MG1655 b1729 -90 3.9 ATATAAGAGCCAGCTCACAGTT
Salmonella typhimurium LT2 STM1320 -91 3.9 ATATAAGAGCCAGCTCACAGTT
Citrobacter koseri ATCC BAA-895 CKO_01755 -90 3.7 ATATAAGAGGTCGGTCACAGTT
Yersinia pestis KIM y1878 -166 3.6 TGATTTGATTTAATACAAATCA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2410 -176 3.7 TGACGTTATCTGCTGCACCCAT
Position: -201
Score: 3.7
Sequence: AAATGTGAAGAGGGTCATAACC
Locus tag: ECSE_1908
ECSE_1908 -201 3.7 AAATGTGAAGAGGGTCATAACC
Supported by regulated orthologs from reference regulons
Ortholog gene name: chbB
Ortholog function: N,N'-diacetylchitobiose-specific PTS system , EIIB component
Escherichia coli str. K-12 substr. MG1655 b1738 -201 3.7 AAATGTGAAGAGGGTCATAACC
Citrobacter koseri ATCC BAA-895 CKO_01763 -188 4.1 AAATGTGAGAGGGGTCATAACA
Enterobacter sp. 638 Ent638_1706 -129 3.9 AATTTTGATTAACCGCGAATTA
Position: -106
Score: 3.5
Sequence: TTTCTTGCTTACCGTCACATTC
Locus tag: ECSE_1932
ECSE_1932 -106 3.5 TTTCTTGCTTACCGTCACATTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: gdhA
Ortholog function: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
Escherichia coli str. K-12 substr. MG1655 b1761 -106 3.5 TTTCTTGCTTACCGTCACATTC
Salmonella typhimurium LT2 STM1299 -107 3.6 TTTCTTGCTTACCGTCACATTG
-55 3.6 TATTCTGATAAAACGCAAATAC
Citrobacter koseri ATCC BAA-895 CKO_01789 -107 3.4 TTTCTTGCTTACCGTCACACTG
Enterobacter sp. 638 Ent638_1685 -110 3.3 AATTTTCACTTGCCTCGCAAAG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0051 -234 3.6 TTTTGTTATATAACAAAAACTT
Proteus mirabilis HI4320 PMI3008 -195 3.4 AATCCTGATTTTATTAGCCTTT
-88 3.5 AAACAATATCAACCTCACATAA
Photorhabdus luminescens subsp. laumondii TTO1 plu0122 -92 3.5 AAACACAACTTACCTCACATTT
Position: -137
Score: 5.2
Sequence: AAATGTGATTTTCATCACGATT
Locus tag: ECSE_1949
ECSE_1949 -137 5.2 AAATGTGATTTTCATCACGATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: msrB
Ortholog function: methionine sulfoxide reductase B
Escherichia coli str. K-12 substr. MG1655 b1778 -137 5.2 AAATGTGATTTTCATCACGATT
Salmonella typhimurium LT2 STM1291 -107 4.7 TAATGTGACATCAGTCACGATT
Citrobacter koseri ATCC BAA-895 CKO_01799 -107 4.9 AAACGTGATTCCGATCACGATT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01198 -135 5.1 AAACGTGATTTAAGTCACAATT
Enterobacter sp. 638 Ent638_1676 -137 5.2 ATATGTGAGAAAGATCACAATT
Erwinia amylovora ATCC 49946 EAM_1930 -137 5.2 AATGGTGATCTGCATCACAATT
Yersinia pestis KIM y2164 -85 5.1 ATTTGCGATTTTTATCACATTT
Serratia proteamaculans 568 Spro_2727 -143 5.7 ATATGTGATCGGTATCACATAT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2343 -135 5.6 TTATGTGATACACATCACAATT
Edwardsiella tarda EIB202 ETAE_1484 -91 4.9 GTTTGTGATGCTCATCACAAAA
Proteus mirabilis HI4320 PMI1503 -137 5.3 TTATGTGAAATGTATCACATTT
Photorhabdus luminescens subsp. laumondii TTO1 plu2557 -267 4.6 ATATGCGAGTCACATCACAATA
Position: -226
Score: 5.3
Sequence: AATCGTGATGAAAATCACATTT
Locus tag: ECSE_1950
ECSE_1950 -226 5.3 AATCGTGATGAAAATCACATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: gapA
Ortholog function: glyceraldehyde-3-phosphate dehydrogenase
Escherichia coli str. K-12 substr. MG1655 b1779 -226 5.3 AATCGTGATGAAAATCACATTT
Salmonella typhimurium LT2 STM1290 -226 4.8 AATCGTGACTGATGTCACATTA
Citrobacter koseri ATCC BAA-895 CKO_01800 -226 5 AATCGTGATCGGAATCACGTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01197 -225 5.2 AATTGTGACTTAAATCACGTTT
Enterobacter sp. 638 Ent638_1675 -225 5.7 AATTGTGATCTTTCTCACATAT
Erwinia amylovora ATCC 49946 EAM_1931 -215 5.4 AATTGTGATGCAGATCACCATT
Yersinia pestis KIM y2165 -218 5.1 AAATGTGATAAAAATCGCAAAT
Serratia proteamaculans 568 Spro_2728 -227 5.6 ATATGTGATACCGATCACATAT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2344 -235 5.8 AATTGTGATGTGTATCACATAA
Edwardsiella tarda EIB202 ETAE_1483 -227 5.1 TTTTGTGATGAGCATCACAAAC
Proteus mirabilis HI4320 PMI1504 -226 5.6 AAATGTGATACATTTCACATAA
Photorhabdus luminescens subsp. laumondii TTO1 plu2558 -224 5.4 TATTGTGATGTGACTCGCATAT
Position: -131
Score: 3.7
Sequence: AATAGTGACGCGCTTCGCAACC
Locus tag: ECSE_1979
ECSE_1979 -131 3.7 AATAGTGACGCGCTTCGCAACC
Supported by regulated orthologs from reference regulons
Ortholog gene name: fadD
Ortholog function: long-chain-fatty-acid--CoA ligase
Escherichia coli str. K-12 substr. MG1655 b1805 -131 3.7 AATAGTGACGCGCTTCGCAACC
Salmonella typhimurium LT2 STM1818 -131 3.7 AATAGTGACGCGCTTCGCAACC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02322 -97 3.7 AATAGTGACGCGCTTCGCAACC
Erwinia amylovora ATCC 49946 EAM_1956 -130 3.9 TTTAGTGATGCGCTTCGCAACC
Yersinia pestis KIM y2236 -80 4.1 AATAGTGATGTATATCTCAACC
Serratia proteamaculans 568 Spro_2760 -99 3.9 ATTAGTGACGTACATCGCAACC
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2372 -132 3.8 ATTAGTGATCGTTCTCGCAACC
-75 3.7 TAAAATAATGTTAATAACAATA
Proteus mirabilis HI4320 PMI1166 -121 4.4 TTTAGTGATACACTTCGCATCT
Photorhabdus luminescens subsp. laumondii TTO1 plu2134 -288 3.8 AAATGCTATCTTAAGCAAAAAA
-137 4 ATTAGTGATGTGTATCTCAACC
Position: -60
Score: 3.8
Sequence: TATTGTGTTGATTATCACTCAG
Locus tag: ECSE_1992
ECSE_1992 -60 3.8 TATTGTGTTGATTATCACTCAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: manY
Ortholog function: PTS system, mannose/fructose/sorbose family, IIC subunit
Escherichia coli str. K-12 substr. MG1655 b1818 -60 3.8 TATTGTGTTGATTATCACTCAG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02334 -163 3.8 TTAACGGATCTTCATCACATTA
Enterobacter sp. 638 Ent638_2387 -166 3.8 ATTACGGATCTTCATCACATAA
Yersinia pestis KIM y2552 -231 3.9 ATAGATGAGCAATGTCACATAA
Edwardsiella tarda EIB202 ETAE_1558 -267 3.9 ATTAACGATGGGCGTCACATAA
Position: -350
Score: 3.7
Sequence: ATTTGTTATTTATTTTAACGTT
Locus tag: ECSE_1995
ECSE_1995 -350 3.7 ATTTGTTATTTATTTTAACGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: b1821
Ortholog function: hypothetical protein
Salmonella typhimurium LT2 STM1834 -276 3.7 AATTGTTATTTAATTTAACGTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2389 -267 3.8 TAGTGTTGTTTGCATCATAAAT
Proteus mirabilis HI4320 PMI1608 -272 3.8 AATTATTATCAATATCATCTTT
-237 3.9 TAATATGTTGCCTTTCATAAAT
Photorhabdus luminescens subsp. laumondii TTO1 plu2701 -281 3.9 TATTGTGCTATCTTTTAAATTG
-179 3.7 AAACGTGGTGCGGGTAACCTTA
Position: -271
Score: 5.4
Sequence: TTGTGTGATCTGCATCACACAT
Locus tag: ECSE_2127
ECSE_2127 -271 5.4 TTGTGTGATCTGCATCACACAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: flhD
Ortholog function: DNA-binding transcriptional dual regulator with FlhC
Escherichia coli str. K-12 substr. MG1655 b1892 -280 5.1 TTGTGTGATCTGCATCACGCAT
Position: -112
Score: 4.2
Sequence: CGATGTGATATTGCTCTCCTAT
Locus tag: ECSE_2133
ECSE_2133 -112 4.2 CGATGTGATATTGCTCTCCTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: araF
Ortholog function: L-arabinose-binding periplasmic protein
Escherichia coli str. K-12 substr. MG1655 b1901 -163 4.2 CGATGTGATATTGCTCTCCTAT
Citrobacter koseri ATCC BAA-895 CKO_01050 -164 4 CGGTGTGATGCCGCTCTCCTAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02396 -161 4 CGATGTGATAATGCTCTCGTAT
-72 3.6 TGTTTTGATGACGATTAAATTG
Enterobacter sp. 638 Ent638_2476 -162 3.7 CGGTGTGATGGCGCTCTCTTAT
Erwinia amylovora ATCC 49946 EAM_1698 -251 4.3 TTATGTGATGGCCTTCATATGT
Yersinia pestis KIM y2096 -283 4.3 TTTTGTGATGTCAGTCAAAAGT
Serratia proteamaculans 568 Spro_2245 -251 3.8 TTTTGTGACGGCTGTCATAAGT
Position: -201
Score: 4
Sequence: TGTTTTAAGCTCACTCACATAT
Locus tag: ECSE_2182
ECSE_2182 -201 4 TGTTTTAAGCTCACTCACATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: rcsA
Ortholog function: Colanic acid capsular biosynthesis activation accesory protein RcsA, co-regulator with RcsB
Escherichia coli str. K-12 substr. MG1655 b1951 -201 4 TGTTTTAAGCTCACTCACATAT
Salmonella typhimurium LT2 STM1982 -201 4 TGTTTTTACTTCACTCACATAA
Citrobacter koseri ATCC BAA-895 CKO_00992 -200 4.1 TGTTTTTACCTTACTCACATAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02421 -195 3.7 TGTTTTTAATTCGGTCACACTA
Enterobacter sp. 638 Ent638_2542 -206 4.3 TGTTTTTATGCCCTTCACAATA
Position: -269
Score: 4.6
Sequence: TGGTGTGATCAGGCGCACATTA
Position: 24
Score: 5.4
Sequence: AAATGTGACTTTTATCACATAA
Locus tag: ECSE_2193
ECSE_2193 -269 4.6 TGGTGTGATCAGGCGCACATTA
24 5.4 AAATGTGACTTTTATCACATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: b1963
Ortholog function: orf, hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b1963 -287 4.6 TGGTGTGATCAGGCGCACATTA
Salmonella typhimurium LT2 STM1994 -70 5.5 AAATGTGATTAATATCACATTA
-34 4.4 TCATATGACTTACATCACAAAA
Position: -93
Score: 3.5
Sequence: GAGTGCGAGTCTGCTCGCATAA
Locus tag: ECSE_2282
ECSE_2282 -93 3.5 GAGTGCGAGTCTGCTCGCATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: sbmC
Ortholog function: DNA gyrase inhibitor
Escherichia coli str. K-12 substr. MG1655 b2009 -93 3.5 GAGTGCGAGTCTGCTCGCATAA
Salmonella typhimurium LT2 STM2061 -102 4.1 GATTGCGAGGTTGCTCACAAAA
Citrobacter koseri ATCC BAA-895 CKO_00775 -219 3.5 GAGTGCGAGTCTGCTCACATAC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02467 -88 3.6 CTCTGTGAATTCGCGCACATAC
Enterobacter sp. 638 Ent638_2577 -97 3.6 TCGTGCGAGTCTGCTCGCATAA
-65 3.6 ATATTTGCTGCACATAAAGAAT
Position: -93
Score: 4.4
Sequence: AAATGCGAGGGTAGTCACATTT
Locus tag: ECSE_2283
ECSE_2283 -93 4.4 AAATGCGAGGGTAGTCACATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: dacD2
Ortholog function: D-alanyl-D-alanine carboxypeptidase
Escherichia coli str. K-12 substr. MG1655 b2010 -99 4.3 AAATGAGAGGGTAGTCACATTT
Salmonella typhimurium LT2 STM2062 -95 4.8 AAATGTGCCTTGTGTCACATTT
Position: -43
Score: 4.6
Sequence: AATTGTGACATTTGTCATACAA
Locus tag: ECSE_2337
ECSE_2337 -43 4.6 AATTGTGACATTTGTCATACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yegH
Ortholog function: putative membrane protein
Escherichia coli str. K-12 substr. MG1655 b2063 -43 4.6 AATTGTGACATTTGTCATACAA
Salmonella typhimurium LT2 STM2119 -42 4.5 AATTGTGACAATTGTCATATTA
Citrobacter koseri ATCC BAA-895 CKO_00719 -42 4.5 AATTGTGACAACTGTCATATAA
Enterobacter sp. 638 Ent638_2677 -42 4.4 AAGTGTGACAAATGTCATATAA
Photorhabdus luminescens subsp. laumondii TTO1 plu1559 -193 3.9 ATTTGTTAATGTGATCACATGT
Position: -68
Score: 4.9
Sequence: TAATGTGATCGGTAGCACGTTT
Locus tag: ECSE_2408
ECSE_2408 -68 4.9 TAATGTGATCGGTAGCACGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yohJ
Ortholog function: LrgA family protein
Escherichia coli str. K-12 substr. MG1655 b2141 -68 4.9 TAATGTGATCGGTAGCACGTTT
Salmonella typhimurium LT2 STM2181 -68 4.6 TGATGTGATCGGTAGCACGTTT
Citrobacter koseri ATCC BAA-895 CKO_00648 -68 4.6 TGATGTGATCGGTAGCACGTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02582 -68 5 TGATGTGATCGGTAGCACATTT
Enterobacter sp. 638 Ent638_2744 -68 4.7 TGATGTGATCCGTAGCACGTTT
Yersinia pestis KIM y2654 -32 4.7 TAGTGTGATGGGTAGCACAGAA
Serratia proteamaculans 568 Spro_1570 -62 4.3 ATTTGTGGCGGAGGTCACAGTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2828 -69 4.5 ATTCGTGATCTGTGGCACGTAA
Edwardsiella tarda EIB202 ETAE_1164 -68 4.9 TGATGTGATCAGTAGCACATTT
Proteus mirabilis HI4320 PMI0645 -71 5.2 TATTGTGATCCATAGCACACTT
Position: -78
Score: 5.1
Sequence: TAATGAGATTCAGATCACATAT
Locus tag: ECSE_2410
ECSE_2410 -78 5.1 TAATGAGATTCAGATCACATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cdd
Ortholog function: cytidine deaminase
Escherichia coli str. K-12 substr. MG1655 b2143 -128 4.3 ATTTGCGATGCGTCGCGCATTT
-78 5.1 TAATGAGATTCAGATCACATAT
Salmonella typhimurium LT2 STM2183 -128 4.2 ATTTGCGATACGTCGCGCATTT
-78 4.8 CAATGAGATTTAGATCACATAT
Citrobacter koseri ATCC BAA-895 CKO_00646 -128 4.3 ATTTGCGATGCGTCGCGCATTT
-78 4.8 CAATGAGATTTGGATCACATAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02584 -78 4.4 GAATGAGATATTCATCACATAT
Enterobacter sp. 638 Ent638_2746 -127 4.2 ATTTGCGATGCGTCGCGCAATT
-77 4.9 TAATGAGAACTGGATCACATAT
Erwinia amylovora ATCC 49946 EAM_2202 -124 3.9 ACTTGCGATAAGTCTCTCATTT
-104 4.1 TTTGGTGATGCATTTCATTTAT
-74 4.7 TAGAGCGATTTAGATCACATAT
Yersinia pestis KIM y2657 -75 5 TAATGAGATATAAATCACAATT
Serratia proteamaculans 568 Spro_1568 -127 4.1 ACTTGCGATACATCTCGCAATT
-77 4.5 TAAAGAGATTTACATCACACTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2830 -130 4.6 AATTGAGATACATCTCGCATTT
-79 4.5 TAAAGAGATTCCGATCACAATT
Edwardsiella tarda EIB202 ETAE_1162 -76 4.9 AAAAGTGATTATTATCACAAAT
Proteus mirabilis HI4320 PMI0643 -132 4.4 ATTTGAGATGTATCTCCCAATT
-82 5.1 AAATATGATTTTAATCACATAT
Photorhabdus luminescens subsp. laumondii TTO1 plu1547 -75 4.7 CTATATGATATTTATCACATTA
Position: -236
Score: 4.8
Sequence: ATTTGTGAATCCTTTCACAGTA
Locus tag: ECSE_2413
ECSE_2413 -236 4.8 ATTTGTGAATCCTTTCACAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yeiT
Ortholog function: predicted oxidoreductase
Escherichia coli str. K-12 substr. MG1655 b2146 -112 4.8 ATTTGTGAATCTTTTCACAGTT
Salmonella typhimurium LT2 STM2186 -201 3.5 ATTTATTATCCCTTTAAAATTG
-168 4.1 TATTATGATATAAGGAACAAAT
-121 4.9 TTTTGTGAATTCTTTCACAGAA
Position: -270
Score: 4.5
Sequence: ATCTGTGAGTGATTTCACAGTA
Locus tag: ECSE_2417
ECSE_2417 -270 4.5 ATCTGTGAGTGATTTCACAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mglB
Ortholog function: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
Escherichia coli str. K-12 substr. MG1655 b2150 -270 4.5 ATCTGTGAGTGATTTCACAGTA
Citrobacter koseri ATCC BAA-895 CKO_00641 -270 4.7 ATATGTGAGTAAATTCACAGTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02588 -239 4.8 ATTTGTGAGTAAATTCACAGTA
Enterobacter sp. 638 Ent638_2750 -271 4.4 ATCTGTGAGTAAATTCACAGTA
Yersinia pestis KIM y2662 -212 4.4 ATCTGTGAGAAAATTCACAGTT
Serratia proteamaculans 568 Spro_1563 -229 4.4 ATCTGTGAGAAAATTCACAGAT
Position: -95
Score: 3.9
Sequence: TGCTGTGACTCGATTCACGAAG
Position: -10
Score: 3.4
Sequence: GGTAGTGAATATGATCACCATT
Locus tag: ECSE_2418
ECSE_2418 -95 3.9 TGCTGTGACTCGATTCACGAAG
-10 3.4 GGTAGTGAATATGATCACCATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: galS
Ortholog function: Mgl repressor and galactose ultrainduction factor GalS, HTH-type transcriptional regulator
Escherichia coli str. K-12 substr. MG1655 b2151 -146 3.5 GATAACGATCTGGATCACATTC
-95 3.9 TGCTGTGACTCGATTCACGAAG
Salmonella typhimurium LT2 STM2191 -154 3.5 GATAACGATCTGGATCACATTC
-103 3.5 CCCTGTGATGTTTCTCACGCAG
-38 3.3 ATTTGTGAGCATTTTTGAACTC
Citrobacter koseri ATCC BAA-895 CKO_00640 -157 3.5 GATAACGATCTGGATCACATTC
-106 3.4 CCCTGTGACCTTACTCACGTAG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02589 -160 3.3 GATAACGATCTCGATCACAATC
-109 3.4 CCGTGTGACCTCACTCACGCAG
-33 3.6 TGACGTGCTGTAATTCTCTTAA
Enterobacter sp. 638 Ent638_2751 -160 3.4 GATAACGATCTGGATCACAATC
-109 4.1 CTGTGTGAGCTTCTTCACGTAG
Erwinia amylovora ATCC 49946 EAM_2208 -110 3.4 GGCTGTGAGGTTTCTCACGTAG
Serratia proteamaculans 568 Spro_1562 -135 3.4 AATTGAGATCTGGCGCAGGTAG
-84 3.5 TCCTGTGACGGGATTCACGCAG
Position: -101
Score: 3.8
Sequence: TTATGTGCGCCGCCTCACGCAC
Locus tag: ECSE_2420
ECSE_2420 -101 3.8 TTATGTGCGCCGCCTCACGCAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: folE
Ortholog function: GTP cyclohydrolase I
Escherichia coli str. K-12 substr. MG1655 b2153 -101 3.8 TTATGTGCGCCGCCTCACGCAC
Salmonella typhimurium LT2 STM2193 -101 4 TTATGTGCGCTACCTCACGCAC
Citrobacter koseri ATCC BAA-895 CKO_00638 -98 3.8 TTATGTGCGCCGCCTCACGCAC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02591 -84 3.5 TTCTGTGCGCCACCTCACGCAC
Enterobacter sp. 638 Ent638_2753 -84 3.9 TTATGTGCGCCACCTCACGCAC
Serratia proteamaculans 568 Spro_1560 -121 4.3 AATCTTGACCGGGTTCACGTTA
Proteus mirabilis HI4320 PMI0639 -86 4.9 TAATGTGATTCAGCTCATCTAA
Position: -130
Score: 4.1
Sequence: TTTTGTGCGTTAGTCCACAGAT
Locus tag: ECSE_2444
ECSE_2444 -130 4.1 TTTTGTGCGTTAGTCCACAGAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: spr
Ortholog function: predicted peptidase, outer membrane lipoprotein
Escherichia coli str. K-12 substr. MG1655 b2175 -130 4.1 TTTTGTGCGTTAGTCCACAGAT
Salmonella typhimurium LT2 STM2214 -128 3.7 ATTTGTGCGTTCCGCCACAGAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02608 -292 3.6 TAGGGTAATCTCGTTCTCGTTT
-234 4.2 AATTGTGCGTGACTGCACAAAT
Enterobacter sp. 638 Ent638_2771 -250 3.6 AATCGCTTTGTCTATCACAATT
Yersinia pestis KIM y2908 -128 3.7 GAATGTGCGTTCATGCACATTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2735 -159 3.9 TAATGTGCATTCTGGCACACTT
Edwardsiella tarda EIB202 ETAE_2298 -131 4.4 AAGTGTGTTCTGCTGCACAATT
Proteus mirabilis HI4320 PMI0831 -129 4.2 TTACGTGCTTTAGAGCACGTTT
Position: -200
Score: 3.6
Sequence: AAGGTTGAGTTAGATCGCAGAA
Position: -158
Score: 3.7
Sequence: AAACGTGACCACGCCCGCAGAT
Locus tag: ECSE_2450
ECSE_2450 -200 3.6 AAGGTTGAGTTAGATCGCAGAA
-158 3.7 AAACGTGACCACGCCCGCAGAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yejG
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b2181 -158 3.7 AAACGTGACCACGCCCGCAGAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02614 -204 3.8 AAAGTTGTTTTGGATCACAGAA
Erwinia amylovora ATCC 49946 EAM_2233 -177 3.6 AAATGAGCATTACTTCTCAAAA
Yersinia pestis KIM y2914 -238 4.4 AAATGGGATCTGAATCCCAAAT
Serratia proteamaculans 568 Spro_3250 -214 4.2 AAATGCGAGCTGAGTCGCAAAA
-121 4.1 GCTTGTGATGTTTTTTACATTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2740 -178 4 ATTCGTGATCAGTTTGGCATTA
-101 3.8 TGTTGTTTTTTTGTTCACGAAA
Photorhabdus luminescens subsp. laumondii TTO1 plu2865 -185 4.1 AAATGAGAGATTGATCTCACTT
-183 3.6 ATGAGAGATTGATCTCACTTTT
-141 3.8 TAATGTAATACTATAAACACAA
Position: -54
Score: 4.1
Sequence: AGTTGTGAATTTGCACAAATTT
Locus tag: ECSE_2552
ECSE_2552 -54 4.1 AGTTGTGAATTTGCACAAATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yfbV
Ortholog function: putative cytoplasmic protein
Escherichia coli str. K-12 substr. MG1655 b2295 -263 3.6 ATTTATGATTAACATCATGCAC
-54 4.1 AGTTGTGAATTTGCACAAATTT
Erwinia amylovora ATCC 49946 EAM_2300 -44 4 TTGTGTGTTTTTTTTAAAATTT
Edwardsiella tarda EIB202 ETAE_2396 -34 3.6 TTTTTTAACTCTTATCGAATAA
Proteus mirabilis HI4320 PMI1770 -290 3.7 ATTAATGATACGCATCATGCTT
-260 3.6 AAACTTGATGCTAATTATAGTT
Position: -263
Score: 4.8
Sequence: ATAAGTGACCGAAATCACACTT
Position: -241
Score: 3.9
Sequence: AAAAATGATCTAAAACAAAATT
Locus tag: ECSE_2653
ECSE_2653 -263 4.8 ATAAGTGACCGAAATCACACTT
-241 3.9 AAAAATGATCTAAAACAAAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: fadL
Ortholog function: Long-chain fatty acid transport protein
Escherichia coli str. K-12 substr. MG1655 b2344 -269 4.8 ATAAGTGACCGAAATCACACTT
-247 3.9 AAAAATGATCTAAAACAAAATT
Salmonella typhimurium LT2 STM2391 -262 4.8 TTAAGTGACCGAAATCACACTT
-240 3.9 AAAAATGATCTAAAACAAAAAT
Citrobacter koseri ATCC BAA-895 CKO_00446 -263 4.8 ATAAGTGACCGAAATCACACTT
-241 3.9 AAAAATGATCTAAAACAAAAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02726 -264 4.7 TTAAGTGACAGAAATCACACTT
-242 3.9 AAAAATGATCTAAAACAAAAAT
Enterobacter sp. 638 Ent638_2884 -269 4.2 GTAAGTGACCGATATCACACTA
-247 4 AAAAATGATCTAGCGCAAAAAT
-214 3.7 ATGAGTGCGACGGCTCGCATTT
Erwinia amylovora ATCC 49946 EAM_2348 -194 3.9 TTTTGTTAAGCAGATCTCTTTT
Serratia proteamaculans 568 Spro_3381 -271 5.1 TTAAGTGATGGAAATCACAAAT
-196 3.8 TTTTGTTAGCCAGATCTCTCTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3081 -332 3.8 AATTTTTATCTTCCTTATATTT
-262 4.9 TTTAGTGATATCAGTCACATTA
Proteus mirabilis HI4320 PMI1810 -326 3.7 AAGTGTTAATTATCTATCATAA
-186 4.2 TAATGTTAACTAAATCCCAAAT
Position: -116
Score: 4.1
Sequence: TTGTGTGACCCAGATCGATATT
Locus tag: ECSE_2685
ECSE_2685 -116 4.1 TTGTGTGACCCAGATCGATATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: glk
Ortholog function: glucokinase
Escherichia coli str. K-12 substr. MG1655 b2388 -116 4.1 TTGTGTGACCCAGATCGATATT
Salmonella typhimurium LT2 STM2403 -116 3.9 TTCTGTGATGAAGATCTATATT
Citrobacter koseri ATCC BAA-895 CKO_00412 -116 4.5 TTATGTGATGCAGATCGATATT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02738 -117 4.4 AAATGTGACCTGTGTCGCTAAA
Enterobacter sp. 638 Ent638_2921 -116 3.8 TTCTGTGACGAAGATCGATTAT
Yersinia pestis KIM y1505 -113 4.7 TTATGAGATGTCAGTCACAAAA
Serratia proteamaculans 568 Spro_3407 -116 4.8 TTTTGTGATCCGGATCGCTAAT
Position: -109
Score: 4.1
Sequence: AATATCGATCTGGGTCACACAA
Locus tag: ECSE_2686
ECSE_2686 -109 4.1 AATATCGATCTGGGTCACACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yfeO
Ortholog function: Chloride channel protein
Escherichia coli str. K-12 substr. MG1655 b2389 -109 4.1 AATATCGATCTGGGTCACACAA
Salmonella typhimurium LT2 STM2404 -109 3.9 AATATAGATCTTCATCACAGAA
Citrobacter koseri ATCC BAA-895 CKO_00411 -134 4.4 AATATCGATCTGCATCACATAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02739 -192 4.3 TTTAGCGACACAGGTCACATTT
Enterobacter sp. 638 Ent638_2922 -111 3.7 ATAATCGATCTTCGTCACAGAA
Serratia proteamaculans 568 Spro_3408 -249 4.7 ATTAGCGATCCGGATCACAAAA
Position: -183
Score: 4
Sequence: TAATGTTAGCACATTTACATAA
Position: -31
Score: 4.1
Sequence: AAATTTAACCTGCCTCATATTT
Locus tag: ECSE_2689
ECSE_2689 -183 4 TAATGTTAGCACATTTACATAA
-31 4.1 AAATTTAACCTGCCTCATATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nupC
Ortholog function: Nucleoside permease NupC
Escherichia coli str. K-12 substr. MG1655 b2393 -183 4 TAATGTTAGCACATTTACATAA
-84 3.8 TAGTGTGTGTCAGATCTCGTTT
-31 4.1 AAATTTAACCTGCCTCATATTT
Position: -337
Score: 4.2
Sequence: TTTTGTGGCCTGCTTCAAACTT
Position: -209
Score: 3.9
Sequence: TTTTATGATTTGGTTCAATTCT
Locus tag: ECSE_2706
ECSE_2706 -337 4.2 TTTTGTGGCCTGCTTCAAACTT
-209 3.9 TTTTATGATTTGGTTCAATTCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ptsH
Ortholog function: PTS system phosphocarrier protein
Escherichia coli str. K-12 substr. MG1655 b2415 -209 3.9 TTTTATGATTTGGTTCAATTCT
Salmonella typhimurium LT2 STM2431 -209 4.4 TTTTATGATTTGGTTCAAATCT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02762 -206 4 TTTTATGATTTGGTTCAAGTCT
Enterobacter sp. 638 Ent638_2943 -271 4.4 TTTTGTGGTCCACTTCAAACTT
-144 4 TTTTATGATTTGGTTCAAGTCT
Serratia proteamaculans 568 Spro_3448 -149 3.6 TTTTTTGATCTGAAGTGCCAAA
Proteus mirabilis HI4320 PMI1828 -275 4.4 TTTTGTGGTAGAGATCAAACTT
-115 3.6 TAACGTAACATGGCTTATATTA
Position: -31
Score: 4.6
Sequence: CTTAGTGATCTACCTCACCTTT
Locus tag: ECSE_2743
ECSE_2743 -31 4.6 CTTAGTGATCTACCTCACCTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: b2462
Ortholog function: putative carboxysome structural protein, ethanol utilization
Escherichia coli str. K-12 substr. MG1655 b2462 -103 4.6 CTTAGTGATCTACCTCACCTTT
Salmonella typhimurium LT2 STM2470 -168 3.8 AAATGTGATGCACCACGATATT
-103 4.6 CTTAGTGATCTACCTCACCTTT
Citrobacter koseri ATCC BAA-895 CKO_00333 -103 4.6 CTTAGTGATCTACTTCACCTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02796 -102 4.3 CTGAGTGATCCACTTCACCTTT
Position: -257
Score: 3.9
Sequence: ATGAGTGCGTTAATTCACACTT
Locus tag: ECSE_2744
ECSE_2744 -257 3.9 ATGAGTGCGTTAATTCACACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: maeB
Ortholog function: malic enzyme
Escherichia coli str. K-12 substr. MG1655 b2463 -257 3.9 ATGAGTGCGTTAATTCACACTT
Salmonella typhimurium LT2 STM2472 -240 3.8 ATGAGTGTGTTGATTCACACTT
Enterobacter sp. 638 Ent638_2958 -231 4.1 ATACATGACGTACTTAACAAAA
Yersinia pestis KIM y1449 -92 3.7 GATTGTGATAAATCACTCACTA
Serratia proteamaculans 568 Spro_3472 -209 3.6 CTTTGTTATCAAACTCACTATC
-90 4.1 GTTTGTGACGTTTCTCTCACTA
Photorhabdus luminescens subsp. laumondii TTO1 plu2719 -74 4 TGTTATGATTTGACACACAGTA
Position: -83
Score: 4
Sequence: TTTTTTGATGCGTTTAGCGAAA
Position: -53
Score: 3.9
Sequence: AAGTGTGAATTAACGCACTCAT
Locus tag: ECSE_2745
ECSE_2745 -83 4 TTTTTTGATGCGTTTAGCGAAA
-53 3.9 AAGTGTGAATTAACGCACTCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: talA
Ortholog function: Transaldolase (EC 2.2.1.2)
Escherichia coli str. K-12 substr. MG1655 b2464 -83 4 TTTTTTGATGCGTTTAGCGAAA
-53 3.9 AAGTGTGAATTAACGCACTCAT
Salmonella typhimurium LT2 STM2473 -53 3.7 AAGTGTGAATCAACACACTCAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02798 -80 3.7 TTTGGTTATGTACCTCATCAAT
Enterobacter sp. 638 Ent638_2959 -152 3.6 ATTTGTTATCAATTTATAACAA
-83 3.9 TTTTGTTAAGTACGTCATGTAT
Position: -246
Score: 3.8
Sequence: GTATGTGATACACAGCAACATT
Locus tag: ECSE_2752
ECSE_2752 -246 3.8 GTATGTGATACACAGCAACATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yffB
Ortholog function: FIG138056: a glutathione-dependent thiol reductase
Escherichia coli str. K-12 substr. MG1655 b2471 -246 3.8 GTATGTGATACACAGCAACATT
Salmonella typhimurium LT2 STM2482 -282 4 TTATGTGACTTACTGCAATATT
Citrobacter koseri ATCC BAA-895 CKO_00317 -276 4 TTATGTGACTTACTGCAATATT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02804 -218 4 TAATGTGACGTAGAGCAACCTC
-179 4 TAATGTTAAAGCCCTCACATCA
Enterobacter sp. 638 Ent638_2966 -254 4 TTATGTGACCAATAGCAATATT
-77 3.6 ATATGTTATGTTTTGCCAAATA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1292 -138 3.7 TTCTGCAACGCAGTTCACAGTA
Position: -104
Score: 3.5
Sequence: TTCTGTGACGCTTGCCAACATT
Locus tag: ECSE_2822
ECSE_2822 -104 3.5 TTCTGTGACGCTTGCCAACATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: csiE
Ortholog function: Stationary phase inducible protein CsiE
Escherichia coli str. K-12 substr. MG1655 b2535 -104 3.5 TTCTGTGACGCTTGCCAACATT
Salmonella typhimurium LT2 STM2553 -106 3.8 TTCTGTGACACTCCTCAGCATT
Citrobacter koseri ATCC BAA-895 CKO_00245 -105 3.4 TTCTGTGATGCTCGCCAGCATT
-42 3.6 TTTAGCTATCCTTATCAAACAA
Erwinia amylovora ATCC 49946 EAM_2496 -103 3.4 TTTTGTGACCTGCCTTAAAAGC
Yersinia pestis KIM y1328 -161 4.1 TAATGTAACACATAGCGCATTA
Serratia proteamaculans 568 Spro_3633 -276 3.4 AAAGGTGGTGTTCATATCAATA
Position: -125
Score: 4.2
Sequence: TTTATTGATTTAAATCAAAGAA
Locus tag: ECSE_2868
ECSE_2868 -125 4.2 TTTATTGATTTAAATCAAAGAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: grcA
Ortholog function: Autonomous glycyl radical cofactor
Escherichia coli str. K-12 substr. MG1655 b2579 -125 4.2 TTTATTGATTTAAATCAAAGAT
Position: -162
Score: 3.8
Sequence: CTTTGAGATATTCCTCAAGTAA
Position: -81
Score: 4.7
Sequence: TTATGAGATTCCCATCACACAT
Locus tag: ECSE_2882
ECSE_2882 -162 3.8 CTTTGAGATATTCCTCAAGTAA
-81 4.7 TTATGAGATTCCCATCACACAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: raiA
Ortholog function: stationary phase translation inhibitor and ribosome stability factor
Escherichia coli str. K-12 substr. MG1655 b2597 -81 4.8 TTATGAGATTTTCATCACACAT
Citrobacter koseri ATCC BAA-895 CKO_03918 -40 5.2 TAATGTGATTTAAATCACGCTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02919 -88 5.6 AAATGTGATTTATATCACACAT
Enterobacter sp. 638 Ent638_3076 -81 5.4 ATGTGTGATTTAGATCACACAT
Erwinia amylovora ATCC 49946 EAM_2617 -83 5.2 AAATGTGATTTCAATCACGATT
Serratia proteamaculans 568 Spro_0882 -83 4.8 ATACGTGATTTTCATCACGCAT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3349 -86 4 AAAAGCGATCAATCTCACGCTT
Edwardsiella tarda EIB202 ETAE_2834 -82 3.8 ATCCGTGATTTTCCTCTCACAC
Proteus mirabilis HI4320 PMI0391 -82 4.6 AAAAGTGATCTTGATCATGTTT
Photorhabdus luminescens subsp. laumondii TTO1 plu1266 -87 5.1 AATAGTGATTTAGATCACCTTT
Position: -184
Score: 4.6
Sequence: AAGTGTTATTTTGATCGCAAAA
Locus tag: ECSE_2949
ECSE_2949 -184 4.6 AAGTGTTATTTTGATCGCAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mltB
Ortholog function: membrane-bound lytic murein transglycosylase B
Escherichia coli str. K-12 substr. MG1655 b2701 -184 4.6 AAGTGTTATTTTGATCGCAAAA
Salmonella typhimurium LT2 STM2831 -182 4.4 AAGTGTTATTGTGATCGCAAAA
Citrobacter koseri ATCC BAA-895 CKO_04055 -184 4.5 AAGTGTTATTTTGATCTCAAAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03036 -296 4.3 AAGTGTTAAATGGATCGCAAAA
Serratia proteamaculans 568 Spro_3399 -136 4.1 TTCTGTGCTGCCCGTCACGTTT
Position: -93
Score: 4.4
Sequence: TTTTGCGATCAAAATAACACTT
Locus tag: ECSE_2950
ECSE_2950 -93 4.4 TTTTGCGATCAAAATAACACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: srlA
Ortholog function: PTS system, glucitol/sorbitol-specific IIC component (EC 2.7.1.69)
Escherichia coli str. K-12 substr. MG1655 b2702 -93 4.4 TTTTGCGATCAAAATAACACTT
Salmonella typhimurium LT2 STM2832 -93 4.3 TTTTGCGATCACAATAACACTT
Citrobacter koseri ATCC BAA-895 CKO_04056 -93 4.3 TTTTGAGATCAAAATAACACTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03037 -92 4.6 TTTTGCGATCCATTTAACACTT
Serratia proteamaculans 568 Spro_3569 -110 4.9 AATTGTGATCTATTTAAAACAA
Position: -177
Score: 4.2
Sequence: TCAGGTGACCGGTTTCACAAAT
Locus tag: ECSE_2963
ECSE_2963 -177 4.2 TCAGGTGACCGGTTTCACAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ascF
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b2715 -177 4.2 TCAGGTGACCGGTTTCACAAAT
Citrobacter koseri ATCC BAA-895 CKO_04070 -179 4.4 ACAAGTGATCATTCTCACAATT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03051 -168 4.1 CTTAGCGATCAAAATCACAAAA
Enterobacter sp. 638 Ent638_3188 -128 4.4 CAAAGTGATCGTTATCACGAAT
-54 3.7 TTTTGTGAAACCGGTTTCCTAT
Serratia proteamaculans 568 Spro_0576 -189 4.4 AAAAGTGACCACCATCACGAAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2165 -255 3.9 CATGGCGATCGTGGTCACATAA
-212 3.9 TATTGAAATCGCACTCATATAT
Position: -127
Score: 4.8
Sequence: TATGGTGAGCTGATTCACATAA
Locus tag: ECSE_2983
ECSE_2983 -127 4.8 TATGGTGAGCTGATTCACATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ygbI
Ortholog function: Hypothetical transcriptional regulator ygbI
Escherichia coli str. K-12 substr. MG1655 b2735 -166 3.7 TTGTTTGATATTGTGAATATAA
-127 5.2 TATGGTGATCTGATTCACATAA
Salmonella typhimurium LT2 STM2919 -128 4 TGCGGTGAGTTGTTTCACAAAA
-87 3.6 TTTTGTGAAGGCAATCCTCATA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01606 -271 3.6 TAATGTGATTTAATGATAGAAT
-230 4.7 ATATGTGAGAGTTATCACGAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_pKPN4p07051 -233 3.6 TAATGTGATTTAATGATAGAAT
-192 4.7 TTATGTGAGAGTTATCACGAAT
Erwinia amylovora ATCC 49946 EAM_1104 -238 4.5 ATTAGTGATAAACTTCACATCA
Serratia proteamaculans 568 Spro_1493 -211 3.9 ATCAGCGATCGTTGTCACAATT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA4325 -267 4.8 TGTGGTGATTTTTATCACATAA
Edwardsiella tarda EIB202 ETAE_1921 -132 3.9 AACCGTGTTTATCCTCACAAAT
Position: -90
Score: 4.8
Sequence: TTATGTGAATCAGCTCACCATA
Locus tag: ECSE_2984
ECSE_2984 -90 4.8 TTATGTGAATCAGCTCACCATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ygbJ
Ortholog function: D-beta-hydroxybutyrate dehydrogenase (EC 1.1.1.30)
Escherichia coli str. K-12 substr. MG1655 b2736 -90 4.9 TTATGTGAATCAGATCACCATA
Salmonella typhimurium LT2 STM2918 -90 4 TTTTGTGAAACAACTCACCGCA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01605 -91 5 ATTCGTGATAACTCTCACATAT
Erwinia amylovora ATCC 49946 EAM_1106 -90 4.4 TGATGTGAAGTTTATCACTAAT
Serratia proteamaculans 568 Spro_1492 -92 4.1 AATTGTGACAACGATCGCTGAT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA4327 -92 4.5 TTATGTGATAAAAATCACCACA
Edwardsiella tarda EIB202 ETAE_1922 -93 3.9 ATTTGTGAGGATAAACACGGTT
Photorhabdus luminescens subsp. laumondii TTO1 plu2507 -147 3.8 ATAAATAATATAAATCAAATAA
-90 3.7 GAATGTGATAACCATCGTGTAT
Position: -179
Score: 4.2
Sequence: ATTTGAGATCAAGATCACTGAT
Locus tag: ECSE_3056
ECSE_3056 -179 4.2 ATTTGAGATCAAGATCACTGAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: sdaC
Ortholog function: Serine transporter
Escherichia coli str. K-12 substr. MG1655 b2796 -179 4.2 ATTTGAGATCAAGATCACTGAT
Salmonella typhimurium LT2 STM2970 -176 4.2 ATTTGAGATCGGGATCACTGAT
Citrobacter koseri ATCC BAA-895 CKO_04152 -176 4.1 ATTTGGGATCGCGATCACTGAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03139 -158 4.2 ATTTGAGATCGCGATCACTGAT
Enterobacter sp. 638 Ent638_3249 -176 4.1 ATTTGGGATCAGGATCACTGAT
Erwinia amylovora ATCC 49946 EAM_1294 -300 3.6 ATTTGTTAAAAATCGCAAAAAA
-180 3.9 AAATGTGATTCCGATCACCGGC
Yersinia pestis KIM y2862 -286 4.3 AATTGAGATCACGATCACGGTA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3158 -195 3.7 TTCTGTGATCGCCTCAATATTA
Proteus mirabilis HI4320 PMI0672 -283 4.3 ATTTGAGATGGTGATCACGGTA
Position: -144
Score: 4.1
Sequence: TTAGTTGAACCAGGTCACAAAA
Position: -54
Score: 4
Sequence: TAGTGTGAAAGGAACAACATTA
Locus tag: ECSE_3060
ECSE_3060 -144 4.1 TTAGTTGAACCAGGTCACAAAA
-54 4 TAGTGTGAAAGGAACAACATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: fucA
Ortholog function: L-fuculose phosphate aldolase
Escherichia coli str. K-12 substr. MG1655 b2800 -144 4.1 TTAGTTGAACCAGGTCACAAAA
-54 4 TAGTGTGAAAGGAACAACATTA
Salmonella typhimurium LT2 STM2974 -157 4.8 TTAATTGATGTGAATCACAAAA
Citrobacter koseri ATCC BAA-895 CKO_04159 -144 4.7 TTAATTGATGCGTATCACAAAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03151 -155 4.4 ATAATTGACGCGGCTCACAAAA
Edwardsiella tarda EIB202 ETAE_0293 -175 4.2 AGTCTTGATGACGGTCACAAAA
Position: -207
Score: 4.9
Sequence: TAAAGTGATGGTAGTCACATAA
Locus tag: ECSE_3061
ECSE_3061 -207 4.9 TAAAGTGATGGTAGTCACATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: fucP
Ortholog function: L-fucose permease
Escherichia coli str. K-12 substr. MG1655 b2801 -207 4.9 TAAAGTGATGGTAGTCACATAA
-167 4.5 AAGTGTGACCGCCGTCATATTA
Citrobacter koseri ATCC BAA-895 CKO_04160 -219 5 TAAAGTGATGATAATCACATAA
-179 4.8 AAATGTGACCACCATCATATTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03152 -260 4.7 TAAAGTGACAATAATCACATAA
-220 4.6 AAGTGTGACCATCATCATATTA
Position: -164
Score: 3.9
Sequence: TTTTTTTACCCCGATCACGGAT
Locus tag: ECSE_3073
ECSE_3073 -164 3.9 TTTTTTTACCCCGATCACGGAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mltA
Ortholog function: membrane-bound lytic murein transglycosylase A
Escherichia coli str. K-12 substr. MG1655 b2813 -164 3.9 TTTTTTTACCCCGATCACGGAT
Citrobacter koseri ATCC BAA-895 CKO_04178 -164 3.8 TTTTTTCACCCGGATCACGAAA
Position: -131
Score: 4.4
Sequence: AATTGGAATATCCATCACATAA
Locus tag: ECSE_3098
ECSE_3098 -131 4.4 AATTGGAATATCCATCACATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: araE
Ortholog function: sugar transporter
Escherichia coli str. K-12 substr. MG1655 b2841 -131 4.4 AATTGGAATATCCATCACATAA
Salmonella typhimurium LT2 STM3016 -271 4 TTTTATGATCTCATTAGCATAG
-131 4.9 AAGTGTAATATCCATCACATAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03264 -191 4.4 AAGTTTAATGTCCATCACAAAA
Enterobacter sp. 638 Ent638_3294 -209 3.7 CGAGATGACATCGATCACATTT
-130 4.1 AATTGGAATATCCATCACAGAA
Position: -91
Score: 4.6
Sequence: CTTTGTGATAAAAATCACTTTT
Locus tag: ECSE_3101
ECSE_3101 -91 4.6 CTTTGTGATAAAAATCACTTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yqeF
Ortholog function: Acetyl-CoA acetyltransferase (EC 2.3.1.9)
Escherichia coli str. K-12 substr. MG1655 b2844 -91 4.6 CTTTGTGATAAAAATCACTTTT
Salmonella typhimurium LT2 STM3019 -92 4.5 CTTTGTGATAAAACTCACTTTT
Citrobacter koseri ATCC BAA-895 CKO_04222 -92 4.6 CTTTGTGATAAAACTCACCATT
Position: -210
Score: 4.1
Sequence: TTTGGTGACATGTGTCACGCTT
Locus tag: ECSE_3175
ECSE_3175 -210 4.1 TTTGGTGACATGTGTCACGCTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: serA
Ortholog function: D-3-phosphoglycerate dehydrogenase
Escherichia coli str. K-12 substr. MG1655 b2913 -210 4.1 TTTGGTGACATGTGTCACGCTT
Salmonella typhimurium LT2 STM3062 -217 4.5 TTTGGTGACATGTATCACGTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03348 -214 4.6 TTTGGTGACTTCTGTCACATTT
Enterobacter sp. 638 Ent638_3332 -215 4.1 TTCGGTGACTTGTATCACGTTT
Yersinia pestis KIM y3301 -126 4.8 TTTGGTGATATATATCACATTC
Serratia proteamaculans 568 Spro_3923 -215 4.4 TTTGGTGACATATGTCACATTG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3905 -214 3.9 TTTGGTACTTAATATCACATTT
Proteus mirabilis HI4320 PMI2031 -210 4 TTCAGTGATATATATCACACGA
Photorhabdus luminescens subsp. laumondii TTO1 plu3605 -207 4.4 TTTAGTGATATATTTCATATCT
-178 4.2 TTATTTGATCTAAATCCTAATT
-105 4.4 TTATGTGATGGGAATAGCAATC
Position: -213
Score: 4.4
Sequence: AAACGTGACGTAAGTCAGATAA
Locus tag: ECSE_3191
ECSE_3191 -213 4.4 AAACGTGACGTAAGTCAGATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: epd
Ortholog function: D-erythrose 4-phosphate dehydrogenase
Escherichia coli str. K-12 substr. MG1655 b2927 -213 4.7 AAGTGTGATGTGAGTCAGATAA
Salmonella typhimurium LT2 STM3070 -213 5 AAATGTGATGCAGGTCAGATAA
Citrobacter koseri ATCC BAA-895 CKO_04297 -213 4.8 AAGTGTGATGCAGGTCAGATAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03356 -213 4.8 AAATGTGATGTGAGTCATATAG
Enterobacter sp. 638 Ent638_3340 -215 4.5 AAATGTGACGCAAGTCATATAG
Erwinia amylovora ATCC 49946 EAM_2813 -208 4.1 TTTTGTGACGCAGATCGAAAGT
Yersinia pestis KIM y3309 -216 3.7 AATTGTGCCCTTTTTCAGGGAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3913 -194 4.1 TTTTATGACGCAGGTCACTCTT
Edwardsiella tarda EIB202 ETAE_2958 -233 4.9 AATTGTGATGCAATGCACGTTT
Proteus mirabilis HI4320 PMI0241 -253 4.4 AAATGTTAACAAGAGCACATTT
Position: -82
Score: 4.9
Sequence: TGATGTGATTTGCTTCACATCT
Locus tag: ECSE_3211
ECSE_3211 -82 4.9 TGATGTGATTTGCTTCACATCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: galP
Ortholog function: sugar transporter
Escherichia coli str. K-12 substr. MG1655 b2943 -156 3.6 TATGATGATATAACTCAATTAT
-82 4.9 TGATGTGATTTGCTTCACATCT
Salmonella typhimurium LT2 STM3091 -83 4.6 CATTGTGATTAGCCTCACATCT
Citrobacter koseri ATCC BAA-895 CKO_04318 -83 5.3 TAACGTGATTCGAATCACATAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03376 -84 3.8 AGCCGTGATTATAGTCACGTTT
Enterobacter sp. 638 Ent638_3347 -171 3.9 TATTGGGATGCACATCAACTCT
-102 3.7 TAGTGTAACCGATTACACCAAT
-84 5.3 CAATGTGATTTATCTCACATAT
Erwinia amylovora ATCC 49946 EAM_2827 -152 4.1 TCATGTGATCTGTCGCACAGTC
Serratia proteamaculans 568 Spro_1160 -276 4.5 TGGTGTGATATCGGTTACATTT
-100 3.6 TTGTGTAATCGTTTCCACTAAT
-82 4.6 TAATGTGATCGCACTCACTTAC
Edwardsiella tarda EIB202 ETAE_2966 -275 3.7 CAAAGTGAAAACGATTACATTT
-61 4.5 TTATGTGATCATGCGCACTTTA
Position: -125
Score: 4
Sequence: TTTTGTTACCTGCCTCTAACTT
Locus tag: ECSE_3225
ECSE_3225 -125 4 TTTTGTTACCTGCCTCTAACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ansB
Ortholog function: periplasmic L-asparaginase II
Escherichia coli str. K-12 substr. MG1655 b2957 -125 4 TTTTGTTACCTGCCTCTAACTT
Salmonella typhimurium LT2 STM3106 -125 4.3 TTTTGTTATCCATCTCTAAAAA
Citrobacter koseri ATCC BAA-895 CKO_04332 -125 3.6 TTTTGATATCCATCTCTAAAAA
Proteus mirabilis HI4320 PMI0708 -81 3.6 ATTCGTTCTATTTATCACGGAA
Photorhabdus luminescens subsp. laumondii TTO1 plu1616 -76 3.8 AAGTCTGGTATGTATCACAGAT
Position: -166
Score: 5.2
Sequence: AAATGTTATCCACATCACAATT
Position: -116
Score: 3.8
Sequence: TTATTTGCCACAGGTAACAAAA
Locus tag: ECSE_3233
ECSE_3233 -166 5.2 AAATGTTATCCACATCACAATT
-116 3.8 TTATTTGCCACAGGTAACAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nupG
Ortholog function: Nucleoside permease NupG
Escherichia coli str. K-12 substr. MG1655 b2964 -166 5.2 AAATGTTATCCACATCACAATT
-116 3.8 TTATTTGCCACAGGTAACAAAA
Salmonella typhimurium LT2 STM3113 -166 3.9 AAGTGTTAACTCCGTCACCCTT
-116 3.6 ATATTTGTCACAGGTAACAAAA
-50 3.6 AAATGTGCCTTTTAAAACATTC
Citrobacter koseri ATCC BAA-895 CKO_04339 -166 3.9 AAGTGTTAACTCCATCACTCTT
-116 3.6 ATATTTGTCACAGGTAACAAAA
-50 3.6 AAATGTGCCTTTTAAAACATTC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03396 -49 4.2 TAATGTTATTTTAAAAACATAA
Enterobacter sp. 638 Ent638_3369 -163 4.5 AAACGTTATTTGCATCACAATC
-114 3.7 TTTTTTGCGGGAGGTAACAAAA
Position: -124
Score: 3.8
Sequence: AAGTGTGATCGGGGACAATATA
Locus tag: ECSE_3328
ECSE_3328 -124 3.8 AAGTGTGATCGGGGACAATATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: glgS
Ortholog function: glycogen synthesis protein GlgS
Escherichia coli str. K-12 substr. MG1655 b3049 -225 3.4 AATAGTTTCCTTGCTTACATTT
-203 3.4 ATCTGTGTTAATAATAACACAG
-124 3.8 AAGTGTGATCGGGGACAATATA
Salmonella typhimurium LT2 STM3197 -222 3.3 TCGCGTGATAATTTTCATGCTT
-178 4.2 TCATGTGACCCATATCTCCTTA
-117 4.2 TATTGTGATTTTGCGCATTAAA
Citrobacter koseri ATCC BAA-895 CKO_04437 -118 3.4 AAGTGTGATGTCAGGCAACTGA
Position: -104
Score: 5
Sequence: AATTGCGATCTAAATCAAATTA
Locus tag: ECSE_3353
ECSE_3353 -104 5 AATTGCGATCTAAATCAAATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: aer
Ortholog function: aerotaxis sensor receptor, senses cellular redox state or proton motive force
Escherichia coli str. K-12 substr. MG1655 b3072 -104 5 AATTGCGATCTAAATCAAATTA
Salmonella typhimurium LT2 STM3217 -220 3.6 AAAGGTGAGCCAGGGCAGATTT
-105 4 AATTGCGATCCAGAGCAATTTT
Citrobacter koseri ATCC BAA-895 CKO_04485 -290 3.9 ATTGGTGATGTTTTGCGCAATG
-105 5 AATTGCGATCTAAATCAAATTT
Enterobacter sp. 638 Ent638_3527 -106 4.5 AATTGCGATCTGGATCAATTTT
Position: -129
Score: 4.3
Sequence: TTTCGTGATCCAGTTAAAGTAA
Locus tag: ECSE_3357
ECSE_3357 -129 4.3 TTTCGTGATCCAGTTAAAGTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ebgA
Ortholog function: cryptic beta-D-galactosidase, alpha subunit
Escherichia coli str. K-12 substr. MG1655 b3076 -129 4.3 TTTCGTGATCCAGTTAAAGTAA
Serratia proteamaculans 568 Spro_1973 -95 3.6 TTTTGTGATCCCGTCGGCATTG
-63 3.5 TTCTGTGAATTTTACTAAATAT
Position: -112
Score: 3.9
Sequence: CTTTTTGAATCCCATCACAAAC
Locus tag: ECSE_3362
ECSE_3362 -112 3.9 CTTTTTGAATCCCATCACAAAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: fadH
Ortholog function: 2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl coenzyme A reductase)
Escherichia coli str. K-12 substr. MG1655 b3081 -112 3.9 CTTTTTGAATCCCATCACAAAC
Salmonella typhimurium LT2 STM3219 -113 4.3 TTTTTTGAATCCCATCACAATC
Citrobacter koseri ATCC BAA-895 CKO_04487 -113 4.3 TTTTTTGAATCCCATCACAATC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03510 -111 3.9 TTCTTTGAATCCCATCACAATC
Enterobacter sp. 638 Ent638_3539 -111 3.9 ATCTTTGAATCCCATCACATTC
Erwinia amylovora ATCC 49946 EAM_0507 -169 3.8 AACCGTGACTGAGATCGCTAAA
Yersinia pestis KIM y3589 -131 4 ATTCATGACGGCTATCACAATC
Serratia proteamaculans 568 Spro_4309 -126 4.2 ATTCATGACATCTATCACATTC
Proteus mirabilis HI4320 PMI3702 -213 3.8 TATTATTATATGATTAAAAAAT
-103 3.8 TTCCATGATTAAGATCACAACT
Photorhabdus luminescens subsp. laumondii TTO1 plu3990 -161 4.3 TTTCATGACCTTCATCACATTC
Position: -232
Score: 4.5
Sequence: AAAGGTGAGAGCCATCACAAAT
Position: -110
Score: 4.4
Sequence: TTTATTGATCTAACTCACGAAA
Locus tag: ECSE_3373
ECSE_3373 -232 4.5 AAAGGTGAGAGCCATCACAAAT
-110 4.4 TTTATTGATCTAACTCACGAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: uxaC
Ortholog function: Uronate isomerase (EC 5.3.1.12)
Escherichia coli str. K-12 substr. MG1655 b3092 -232 4.5 AAAGGTGAGAGCCATCACAAAT
-110 4.4 TTTATTGATCTAACTCACGAAA
Citrobacter koseri ATCC BAA-895 CKO_04494 -169 4.6 AAAGGTGAGTGACATCACAAAT
-47 4.3 TTTATTGATCCAACTCACGAAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03520 -251 3.8 AAAGTTGAGAGCTGTCACAAAA
-129 4.4 TTTATTGATCTAACTCACGAAA
Enterobacter sp. 638 Ent638_3546 -231 4.6 AAAGGTGAGTGACATCACAAAA
-109 4.4 TTTATTGATCTAACTCACGAAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0645 -229 4.1 AAAGTTGAGTGATATCACAAAA
-109 3.8 TTTTGCGATCATGACCTCACAA
-86 3.7 TCCTGTGAGATATTGCGCATAA
Position: -272
Score: 5.1
Sequence: ATTTGTGATGGCTCTCACCTTT
Locus tag: ECSE_3374
ECSE_3374 -272 5.1 ATTTGTGATGGCTCTCACCTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: exuT
Ortholog function: Hexuronate transporter
Escherichia coli str. K-12 substr. MG1655 b3093 -274 4.2 TTTCGTGAGTTAGATCAATAAA
-152 5.1 ATTTGTGATGGCTCTCACCTTT
Citrobacter koseri ATCC BAA-895 CKO_04495 -250 5.2 ATTTGTGATGTCACTCACCTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03521 -263 4.4 TTTTGTGACAGCTCTCAACTTT
Enterobacter sp. 638 Ent638_3547 -261 4.2 TTTCGTGAGTTAGATCAATAAA
-139 5.2 TTTTGTGATGTCACTCACCTTT
Serratia proteamaculans 568 Spro_4322 -180 4.8 TTTTGTGATATCACTCAACTTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0644 -208 4.8 TTTTGTGATATCACTCAACTTT
Position: -228
Score: 4.6
Sequence: TTTTGTGATCTGCCGCAAATAG
Locus tag: ECSE_3395
ECSE_3395 -228 4.6 TTTTGTGATCTGCCGCAAATAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: yhaO
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b3110 -228 4.6 TTTTGTGATCTGCCGCAAATAG
Salmonella typhimurium LT2 STM3239 -230 4.5 TGTTGTGATACGCGTCAAATAG
Citrobacter koseri ATCC BAA-895 CKO_04511 -180 4.7 TGTTGTGATCTGCTTCAAGAAT
Position: -82
Score: 4.7
Sequence: ATTTGTGAGTGGTCGCACATAT
Locus tag: ECSE_3402
ECSE_3402 -82 4.7 ATTTGTGAGTGGTCGCACATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: tdcA
Ortholog function: Threonine catabolic operon transcriptional activator TdcA
Escherichia coli str. K-12 substr. MG1655 b3118 -225 4 TGATGTTATCGCCATAAAATAT
-82 4.7 ATTTGTGAGTGGTCGCACATAT
Salmonella typhimurium LT2 STM3245 -188 3.9 TTTTTTGATTGAAATCAGGCTA
-83 4.7 ATTTGTGAGTGGTCGCACATAA
Citrobacter koseri ATCC BAA-895 CKO_04518 -225 4.3 ATATGTTATCGCCATAAAATAT
-187 3.9 TTTTTTGACAAAAATCATGATA
-82 4.6 ATTTGTGAGTAGTCGCACATAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02296 -82 4.6 CTTTGTGAGAGCTCTCACATAA
-54 3.7 AATTGCGATTTGTTACACTTTC
Enterobacter sp. 638 Ent638_3565 -82 3.9 ATTTGTGAGTAACAGCACATCC
Position: -269
Score: 4.4
Sequence: AAATGTGATCAATGTCAATCAT
Locus tag: ECSE_3411
ECSE_3411 -269 4.4 AAATGTGATCAATGTCAATCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: garP
Ortholog function: d-galactonate transporter
Escherichia coli str. K-12 substr. MG1655 b3127 -269 4.4 AAATGTGATCAATGTCAATCAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03539 -289 4.5 AAATGTGATCGGCATCACTCCT
Enterobacter sp. 638 Ent638_3569 -291 4.7 AAATGTGATCAAGATCACCCCT
Position: -210
Score: 4.2
Sequence: TATTTTGAGCATATGCACATAA
Position: -127
Score: 4.4
Sequence: ATGATTGACATTGATCACATTT
Locus tag: ECSE_3412
ECSE_3412 -210 4.2 TATTTTGAGCATATGCACATAA
-127 4.4 ATGATTGACATTGATCACATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: garD
Ortholog function: D-galactarate dehydratase
Escherichia coli str. K-12 substr. MG1655 b3128 -210 4.2 TATTTTGAGCATATGCACATAA
-127 4.4 ATGATTGACATTGATCACATTT
-52 3.7 AAATGAGACCAGGTCCTCATTT
Salmonella typhimurium LT2 STM3250 -153 4.3 TGCGGTGATCTGGATCACATTC
Citrobacter koseri ATCC BAA-895 CKO_04527 -54 4 AGTTGTTCTCTTTAACACATTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03540 -125 4.8 AGGAGTGATGCCGATCACATTT
Enterobacter sp. 638 Ent638_3570 -143 4.7 AGGGGTGATCTTGATCACATTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3578 -296 4.2 TAGTGCGAGGTATTTCACGAAA
-204 5.1 AAATGTGATCAAACTCACCAAA
Position: -103
Score: 4.7
Sequence: TTTTTTGATTGCCATCACCTTA
Position: -48
Score: 4.4
Sequence: TACTTTGAGCCGGTTCACACTT
Locus tag: ECSE_3448
ECSE_3448 -103 4.7 TTTTTTGATTGCCATCACCTTA
-48 4.4 TACTTTGAGCCGGTTCACACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: deaD
Ortholog function: ATP-independent RNA helicase
Salmonella typhimurium LT2 STM3280.S -154 3.9 CTTTTTGATTGCCATCACCTTC
-99 4.4 TACTTTGAGCCGGTTCACACTT
Citrobacter koseri ATCC BAA-895 CKO_04559 -103 3.9 CTTTTTGATTGCCATCACCTTC
-48 4.4 TACTTTGAGCCGGTTCACACTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03570 -154 3.8 TTTTTTGCTTGCCATCACCTTC
-99 4.4 TACTTTGAGCCGGTTCACACAT
Enterobacter sp. 638 Ent638_3599 -154 4.1 TCTTATGATTGCCATCACCTTA
-99 4.4 TACTTTGAGCCGGTTCACACTT
Erwinia amylovora ATCC 49946 EAM_3065 -99 4.8 TAATTTGAGCCGGTTCACACTT
Yersinia pestis KIM y0696 -96 4.8 TAATTTGAGCCGGTTCACACTT
Serratia proteamaculans 568 Spro_0495 -96 4.8 TAATTTGAGCCGGTTCACACTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0718 -96 4.4 CAATTTGAGCCGGTTCACACTT
Edwardsiella tarda EIB202 ETAE_0411 -96 4.8 TAATTTGAGCCGGTTCACACTT
Proteus mirabilis HI4320 PMI3424 -80 5 TAATTTGAGCCAGTTCACATTT
Photorhabdus luminescens subsp. laumondii TTO1 plu4523 -95 5 TAATTTGAGCCAGTTCACATTT
Position: -253
Score: 4.6
Sequence: TATAGTGATCCACGCCACATTT
Position: -139
Score: 3.5
Sequence: TTATTTTACAAAAAACACACTA
Locus tag: ECSE_3457
ECSE_3457 -253 4.6 TATAGTGATCCACGCCACATTT
-139 3.5 TTATTTTACAAAAAACACACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: argG
Ortholog function: Argininosuccinate synthase (EC 6.3.4.5)
Escherichia coli str. K-12 substr. MG1655 b3172 -253 4.6 TATAGTGATCCACGCCACATTT
Erwinia amylovora ATCC 49946 EAM_0139 -121 3.5 AATAGTGAATAAAAATACAATA
Serratia proteamaculans 568 Spro_4779 -167 4 TATTGTGAATAAAAATACAATA
Edwardsiella tarda EIB202 ETAE_3480 -160 3.4 AATTATGAATAAAAATACAATA
Proteus mirabilis HI4320 PMI3239 -57 3.6 TTTTTTGAATAAAAATACATTA
Photorhabdus luminescens subsp. laumondii TTO1 plu4742 -59 3.6 TTTTTTGAATAAAAATACATTA
Position: -91
Score: 3.7
Sequence: ATTTGTTACATGAATCAGTTAA
Position: -69
Score: 4
Sequence: ATGTGTGATGCGTACCATTTTT
Locus tag: ECSE_3493
ECSE_3493 -91 3.7 ATTTGTTACATGAATCAGTTAA
-69 4 ATGTGTGATGCGTACCATTTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: elbB
Ortholog function: sigma cross-reacting protein 27A (SCRP-27A)
Escherichia coli str. K-12 substr. MG1655 b3209 -91 3.7 ATTTGTTACATGAATCAGTTAA
-69 4 ATGTGTGATGCGTACCATTTTT
Salmonella typhimurium LT2 STM3327 -91 3.9 ATTTGTTACATGAATCATTTAA
-69 3.6 ATGTGTGAAGCGTAGCATTTTA
Citrobacter koseri ATCC BAA-895 CKO_04612 -92 3.7 TTTTGTTACATGAATCAGTTAA
-70 3.6 ATGTGTGAAGCGCAGCATTTTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03618 -93 3.6 ATTTGTTACATGAATCAGTAAA
-71 3.8 ATATGTGAAGCATAGCGAGTTA
Serratia proteamaculans 568 Spro_4341 -72 3.7 ATGTGTGATGTAGATTAGTGTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0316 -72 3.7 ATGTGTGATGTAGATTAGTGTT
Proteus mirabilis HI4320 PMI3679 -174 4.1 TTTTTTGATTATCATTACATAG
Position: -115
Score: 4.6
Sequence: TTTAGTGAAGCAGATCGCATTA
Locus tag: ECSE_3504
ECSE_3504 -115 4.6 TTTAGTGAAGCAGATCGCATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanA
Ortholog function: N-acetylneuraminate lyase (EC 4.1.3.3)
Escherichia coli str. K-12 substr. MG1655 b3225 -115 4.6 TTTAGTGAAGCAGATCGCATTA
Salmonella typhimurium LT2 STM3339 -113 4.4 TTTAGTGAAGCAGATCGCACTA
Citrobacter koseri ATCC BAA-895 CKO_04629 -116 4.2 TTTAGTGAAGTAGATCGCACTC
Enterobacter sp. 638 Ent638_3661 -112 4.6 TTTAGTGAAGCAGATCGCATTA
Edwardsiella tarda EIB202 ETAE_1381 -141 4.5 TTTAGTGAACTAGATCGCACAA
Position: -60
Score: 5.1
Sequence: TTTTGTGATATGGGTCACGAAA
Locus tag: ECSE_3517
ECSE_3517 -60 5.1 TTTTGTGATATGGGTCACGAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yhcN
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b3238 -60 5.1 TTTTGTGATATGGGTCACGAAA
Salmonella typhimurium LT2 STM3361 -60 5 TTTTGTGATGAGGGTCACGAAA
Citrobacter koseri ATCC BAA-895 CKO_04644 -60 5 TTTTGTGATGAGGGTCACGAAA
Enterobacter sp. 638 Ent638_3673 -58 5 TTTTGTGATGAGGGTCACGAAA
Position: -167
Score: 5.4
Sequence: AAAAGTGATTTAGATCACATAA
Locus tag: ECSE_3521
ECSE_3521 -167 5.4 AAAAGTGATTTAGATCACATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yhcR
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b3242 -167 5.4 AAAAGTGATTTAGATCACATAA
Salmonella typhimurium LT2 STM3366 -166 5.4 AAAAGTGATTTAGATCACATAA
Citrobacter koseri ATCC BAA-895 CKO_04650 -168 5.4 AAAAGTGATTTAGATCACATAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03651 -116 5.2 AAAAGTGATTTAGATCACACAT
-63 3.7 TATTGTTAGCTACATAATAAAC
Enterobacter sp. 638 Ent638_3679 -165 5.4 AAAAGTGATTTAGATCACATAT
Yersinia pestis KIM y0179 -269 5.2 AAAAGTGATTTAGATCACACAT
Serratia proteamaculans 568 Spro_4392 -293 5.1 AAAAGTGATTTAGATCACAGAT
-89 3.8 ATTTGTGGTGCGTGTCAGCTAA
Position: -37
Score: 5.3
Sequence: TTATGTGATCTAAATCACTTTT
Locus tag: ECSE_3522
ECSE_3522 -37 5.3 TTATGTGATCTAAATCACTTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: aaeR
Ortholog function: LysR-family transcriptional regulator
Escherichia coli str. K-12 substr. MG1655 b3243 -37 5.3 TTATGTGATCTAAATCACTTTT
Salmonella typhimurium LT2 STM3367 -37 5.3 TTATGTGATCTAAATCACTTTT
Citrobacter koseri ATCC BAA-895 CKO_04651 -37 5.3 ATATGTGATCTAAATCACTTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03652 -55 5.1 ATGTGTGATCTAAATCACTTTT
Enterobacter sp. 638 Ent638_3680 -37 5.3 ATATGTGATCTAAATCACTTTT
Erwinia amylovora ATCC 49946 EAM_3128 -37 5.3 AAATGTGATCTAAATCACTTTT
Yersinia pestis KIM y0180 -55 5.1 ATGTGTGATCTAAATCACTTTT
Serratia proteamaculans 568 Spro_4393 -37 4.9 ATCTGTGATCTAAATCACTTTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0276 -37 5.1 TAGTGTGATCTAAATCACTTTT
Edwardsiella tarda EIB202 ETAE_3129 -131 4.5 ATCTGTGACGCAAATCACTTTT
Position: -297
Score: 4.4
Sequence: AAGTGCGAGCAAGCTCACAAAA
Position: -212
Score: 4.3
Sequence: AATTGAGAACTTACTCAAATTT
Locus tag: ECSE_3541
ECSE_3541 -297 4.4 AAGTGCGAGCAAGCTCACAAAA
-212 4.3 AATTGAGAACTTACTCAAATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: dusB
Ortholog function: tRNA-dihydrouridine synthase B
Escherichia coli str. K-12 substr. MG1655 b3260 -297 4.4 AAGTGCGAGCAAGCTCACAAAA
-212 4.3 AATTGAGAACTTACTCAAATTT
Citrobacter koseri ATCC BAA-895 CKO_04672 -212 3.7 AAATGAGAAGTTACGCAAAATT
Enterobacter sp. 638 Ent638_3699 -299 4.1 AAATGGGACCCAGATCGCAAAG
Erwinia amylovora ATCC 49946 EAM_3146 -219 4 TATTGTTAACTTGCTCACAAGA
Yersinia pestis KIM y0213 -57 4.3 TAACGTGATGTTATTTATAATT
Proteus mirabilis HI4320 PMI3623 -94 3.8 TTTCGCGATTTGGTTAAACTTT
Photorhabdus luminescens subsp. laumondii TTO1 plu4088 -191 3.7 CTAAGTGATAAACTTTACCAAT
Position: -4
Score: 3.8
Sequence: TCCTGTGAAGTGTTTCACGTTG
Locus tag: ECSE_3554
ECSE_3554 -4 3.8 TCCTGTGAAGTGTTTCACGTTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: yrdA
Ortholog function: carbonic anhydrase, family 3
Escherichia coli str. K-12 substr. MG1655 b3279 -220 3.8 TCCTGTGAAGTGTTTCACGTTG
Salmonella typhimurium LT2 STM3399 -222 4.3 TTGTGTGAAGTGATTCACATCC
Citrobacter koseri ATCC BAA-895 CKO_04691 -221 3.9 TCTTGTGAAGCGTTTCACTTTG
-81 3.8 ATTTTTGATACCTGAAACACTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03680 -221 4.6 TTGTGTGAAGTGATTCACATCT
Enterobacter sp. 638 Ent638_3711 -222 4.6 TTGTGTGAAGTGATTCACATCT
-47 3.6 TAATGCGATCAAAGTCTTCTAT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3993 -105 3.6 TTACTCGATCCGTGTCACTTTT
Edwardsiella tarda EIB202 ETAE_3192 -235 4.1 TCCTGTGATGTTGTTCACATGT
Position: -187
Score: 4.2
Sequence: TAATGTGACGTCCTTTGCATAC
Locus tag: ECSE_3618
ECSE_3618 -187 4.2 TAATGTGACGTCCTTTGCATAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: yhfA
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b3356 -187 4.2 TAATGTGACGTCCTTTGCATAC
Salmonella typhimurium LT2 STM3465 -188 3.9 TAATGTGATGTCCTCTGCATAC
Citrobacter koseri ATCC BAA-895 CKO_04775 -187 3.3 GAATGTGATGTCCTCTGCATAC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03742 -188 3.5 TAATGTGAACTCCTCTGCATAC
Serratia proteamaculans 568 Spro_4579 -280 3.3 GGTTTTGAGGCGTGTCATAAAT
Position: -154
Score: 3.3
Sequence: TACATTGATGTACTGCATGTAT
Position: -136
Score: 3.3
Sequence: GTATGCAAAGGACGTCACATTA
Locus tag: ECSE_3619
ECSE_3619 -154 3.3 TACATTGATGTACTGCATGTAT
-136 3.3 GTATGCAAAGGACGTCACATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: crp
Ortholog function: cyclic AMP receptor protein
Escherichia coli str. K-12 substr. MG1655 b3357 -154 3.3 TACATTGATGTACTGCATGTAT
-136 3.3 GTATGCAAAGGACGTCACATTA
Salmonella typhimurium LT2 STM3466 -159 3.1 TACATTGACGTACTGCATGTAT
Citrobacter koseri ATCC BAA-895 CKO_04777 -160 3.1 TACATTGACGTACTGCATGTAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03743 -158 3.3 TACATTGATGTACTGCATGTAT
Enterobacter sp. 638 Ent638_3784 -128 2.9 AAACATTACAGGCTGCAAACAT
Yersinia pestis KIM y3956 -309 3 AATTTAGACTACCCTTTCATTT
Serratia proteamaculans 568 Spro_4580 -121 3.5 ATTTATGACACGCCTCAAAACC
Proteus mirabilis HI4320 PMI2820 -135 3.3 TATTATAATCTATTCCTTATTA
Position: -204
Score: 4.2
Sequence: TTTTGTGATCTGTTTAAATGTT
Position: -151
Score: 4.2
Sequence: AGAGGTGATTTTGATCACGGAA
Locus tag: ECSE_3625
ECSE_3625 -204 4.2 TTTTGTGATCTGTTTAAATGTT
-151 4.2 AGAGGTGATTTTGATCACGGAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ppiA
Ortholog function: Peptidyl-prolyl cis-trans isomerase ppiA precursor (EC 5.2.1.8)
Escherichia coli str. K-12 substr. MG1655 b3363 -204 4.2 TTTTGTGATCTGTTTAAATGTT
-151 4.2 AGAGGTGATTTTGATCACGGAA
Salmonella typhimurium LT2 STM3472 -214 4.3 TTTTGTGATGCATTTAAATAAT
-161 5.1 TAATGTGATGTTTGTCACATCA
Citrobacter koseri ATCC BAA-895 CKO_04785 -215 3.7 TTTAGTGATGTATTTAAATGTT
-162 5.2 TAACGTGACATTGATCACATTA
Position: -76
Score: 3.4
Sequence: GAATTTGATTTACATCAATAAG
Locus tag: ECSE_3627
ECSE_3627 -76 3.4 GAATTTGATTTACATCAATAAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: nirB
Ortholog function: nitrite reductase (NAD(P)H) subunit
Escherichia coli str. K-12 substr. MG1655 b3365 -124 3.2 AAAATTTATACAAATCAGCAAT
-76 3.4 GAATTTGATTTACATCAATAAG
Salmonella typhimurium LT2 STM3474 -76 3.4 GAATTTGATTTACATCAATAAG
Citrobacter koseri ATCC BAA-895 CKO_04789 -76 3.4 GAATTTGATTTACATCAATAAG
Enterobacter sp. 638 Ent638_3793 -76 3.3 GTATTTGATTTGCATCAATAAG
Yersinia pestis KIM y3945 -75 3.7 CAAATTGATTTACATCAAGAAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA4079 -186 4.2 AAGCGTGCTATAGATCTCACTT
Proteus mirabilis HI4320 PMI1479 -129 3.5 TTTTGTGCACTTTATTAACAAT
Position: -53
Score: 3.7
Sequence: AAGCGTGTCCGATATCGCACAA
Locus tag: ECSE_3658
ECSE_3658 -53 3.7 AAGCGTGTCCGATATCGCACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nudE
Ortholog function: ADP compounds hydrolase NudE (EC 3.6.1.-)
Escherichia coli str. K-12 substr. MG1655 b3397 -53 3.7 AAGCGTGTCCGATATCGCACAA
Citrobacter koseri ATCC BAA-895 CKO_04820 -54 4.1 AACCGTGCTGTATATCGCACAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03768 -54 4 AAGCGTGTTGCGTATCGCACAA
Enterobacter sp. 638 Ent638_3810 -55 3.6 AACCGTGCGTCATATCGCACAA
Yersinia pestis KIM y3923 -247 4.5 CAATGTGATCAAGTTCTAATAT
Serratia proteamaculans 568 Spro_4612 -135 4.4 CAATGTGATCAAGATCGGATTT
Edwardsiella tarda EIB202 ETAE_3268 -116 3.6 AAATATGAGCATCTGCGCACAA
Position: -137
Score: 4
Sequence: TTTCGTGACAGGAATCACGGAG
Locus tag: ECSE_3666
ECSE_3666 -137 4 TTTCGTGACAGGAATCACGGAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: pck
Ortholog function: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
Escherichia coli str. K-12 substr. MG1655 b3403 -240 4.2 GAATGCGATTCCACTCACAATA
-137 4 TTTCGTGACAGGAATCACGGAG
Salmonella typhimurium LT2 STM3500 -241 4 GAATGCGATTACAGTCACATTA
-107 3.9 AATCGTGATTTTGTCCAGATAC
Citrobacter koseri ATCC BAA-895 CKO_04825 -107 3.9 AATCGTGATTTTGTCCAGATAC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03773 -242 3.7 GAAAGCGATTACATTCACATTT
-138 3.7 CTTCGTGACAGGAGTCACCGTT
Enterobacter sp. 638 Ent638_3816 -241 4.1 GTATGCGATTACATTCACATTA
Yersinia pestis KIM y3918 -130 4.2 ATTCGTGTTCCATCTCTCATAA
-80 3.8 ATATTTGATAGCTATCGCTGTT
Serratia proteamaculans 568 Spro_4617 -80 4.1 ATATTTGATACCTATCGCGGTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA4106 -81 4 TTTTATGATTGCTATCGCGGTT
Edwardsiella tarda EIB202 ETAE_3277 -82 3.9 TTTTTTGATGACTATCTCGGTT
Proteus mirabilis HI4320 PMI3015 -131 4 ATTTGTGCATTAGTTCTCGTTA
Photorhabdus luminescens subsp. laumondii TTO1 plu0100 -86 3.8 TTTTTTGATAACTATCGCTGTT
Position: -183
Score: 3.9
Sequence: TAACGTGATCATATCAACAGAA
Locus tag: ECSE_3670
ECSE_3670 -183 3.9 TAACGTGATCATATCAACAGAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ompR
Ortholog function: Two-component system response regulator OmpR
Escherichia coli str. K-12 substr. MG1655 b3405 -183 3.9 TAACGTGATCATATCAACAGAA
Enterobacter sp. 638 Ent638_3818 -147 3.9 TTATGTGATGAAATGTGCAGAT
Position: -236
Score: 4.3
Sequence: TAATATGACCAACCTCTCATAA
Locus tag: ECSE_3682
ECSE_3682 -236 4.3 TAATATGACCAACCTCTCATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: gntT
Ortholog function: gluconate transporter
Escherichia coli str. K-12 substr. MG1655 b3415 -236 4.3 TAATATGACCAACCTCTCATAA
Salmonella typhimurium LT2 STM3512 -236 4.1 TAACATGACCTGTGTCTCATAA
-178 3.8 ATATGTTACCCGTATCATTCTT
-37 3.2 TGACGTTACCCATAACAAAGTA
Citrobacter koseri ATCC BAA-895 CKO_04836 -236 4.2 TAACATGACCTGCCTCTCATAA
-178 3.8 ATATGTTACCCGTATCATTCAT
Position: -141
Score: 4.5
Sequence: TTAAGTGGTTGAGATCACATTT
Locus tag: ECSE_3684
ECSE_3684 -141 4.5 TTAAGTGGTTGAGATCACATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: malP
Ortholog function: maltodextrin phosphorylase
Escherichia coli str. K-12 substr. MG1655 b3417 -141 4.5 TTAAGTGGTTGAGATCACATTT
Citrobacter koseri ATCC BAA-895 CKO_04838 -139 4 TTAAGTGGCGGCGATCACACTT
Serratia proteamaculans 568 Spro_4636 -139 4.4 AAAAGTGCCTGAGATCACAATT
Position: -142
Score: 4.3
Sequence: AATTGTGACACAGTGCAAATTC
Locus tag: ECSE_3685
ECSE_3685 -142 4.3 AATTGTGACACAGTGCAAATTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: malT
Ortholog function: transcriptional regulator MalT
Escherichia coli str. K-12 substr. MG1655 b3418 -142 4.3 AATTGTGACACAGTGCAAATTC
Salmonella typhimurium LT2 STM3515 -143 4.3 AATTGTGACAGAGTGCAAATTC
Citrobacter koseri ATCC BAA-895 CKO_04840 -142 4.3 AATTGTGACAGAGTGCAAATTC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03788 -142 4.4 ATTTGTGACATAGAGCAAATTC
Enterobacter sp. 638 Ent638_3831 -142 4.6 AATTGTGACAGAGTGCAAATTA
Yersinia pestis KIM y3900 -202 4.6 AATTGTGATCCGTAGCAACTTA
Serratia proteamaculans 568 Spro_4637 -203 4 AAGTGTGATCAATAGCAATATA
Edwardsiella tarda EIB202 ETAE_3303 -212 3.8 AAATGTGATCAGCCGCAATTTC
Position: -95
Score: 4.7
Sequence: TAGAGTGATATGTATAACATTA
Locus tag: ECSE_3691
ECSE_3691 -95 4.7 TAGAGTGATATGTATAACATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: glpE
Ortholog function: thiosulfate sulfurtransferase
Escherichia coli str. K-12 substr. MG1655 b3425 -95 4.7 TAGAGTGATATGTATAACATTA
Salmonella typhimurium LT2 STM3525 -104 4.7 TAGAGTGATATGTATAACATTA
Citrobacter koseri ATCC BAA-895 CKO_04844 -108 4.6 TAGAGTGATACATATAACATTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03791 -107 4.3 TGAAGTGATGGGTGTAACATAT
Enterobacter sp. 638 Ent638_3834 -257 3.8 ATGTTCGATATCGCTCATAATA
-196 4.6 TTGAGTGATAGAGATAACATAA
Erwinia amylovora ATCC 49946 EAM_3264 -134 3.9 ATGCGTGATGCCGATAACGTCT
Photorhabdus luminescens subsp. laumondii TTO1 plu0197 -102 3.6 TAACGTATTACTGATAACAAAT
Position: -116
Score: 4.4
Sequence: TAATGTTATACATATCACTCTA
Locus tag: ECSE_3692
ECSE_3692 -116 4.4 TAATGTTATACATATCACTCTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: glpD
Ortholog function: glycerol-3-phosphate dehydrogenase
Escherichia coli str. K-12 substr. MG1655 b3426 -116 4.4 TAATGTTATACATATCACTCTA
Salmonella typhimurium LT2 STM3526 -116 4.4 TAATGTTATACATATCACTCTA
Citrobacter koseri ATCC BAA-895 CKO_04845 -116 4.5 TAATGTTATATGTATCACTCTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03792 -119 3.7 ATATGTTACACCCATCACTTCA
-58 3.7 TATAGTGAGCGATATCGAGCAT
Enterobacter sp. 638 Ent638_3835 -116 4.4 TTATGTTATCTCTATCACTCAA
-55 4 TATTATGAGCGATATCGAACAT
Erwinia amylovora ATCC 49946 EAM_3265 -124 4 AGACGTTATCGGCATCACGCAT
Yersinia pestis KIM y3891 -129 4.4 AAATGTTACCTCCATCACGCAT
Serratia proteamaculans 568 Spro_4642 -129 3.6 AACTGTTACCTCTATCACGCCT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA4141 -144 4.3 TAATGTGACAACTATCATCATA
-124 4.4 TATTGTTAGCTTCATCACGCAT
Edwardsiella tarda EIB202 ETAE_3312 -124 4.3 TTGTGTTATCCGCATCGCGTAA
Proteus mirabilis HI4320 PMI2930 -129 4.4 AATTGTTATTTATATCACGCAG
Position: -132
Score: 4.8
Sequence: AAATTTGAAGTAGCTCACACTT
Locus tag: ECSE_3705
ECSE_3705 -132 4.8 AAATTTGAAGTAGCTCACACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: gntK
Ortholog function: gluconate kinase 1
Escherichia coli str. K-12 substr. MG1655 b3437 -132 4.8 AAATTTGAAGTAGCTCACACTT
Position: -182
Score: 3.6
Sequence: ATCCGTGCCCCATCTCCCATTT
Locus tag: ECSE_3719
ECSE_3719 -182 3.6 ATCCGTGCCCCATCTCCCATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ugpB
Ortholog function: Glycerol-3-phosphate ABC transporter, periplasmic glycerol-3-phosphate-binding protein (TC 3.A.1.1.3)
Escherichia coli str. K-12 substr. MG1655 b3453 -182 3.6 ATCCGTGCCCCATCTCCCATTT
Salmonella typhimurium LT2 STM3557 -184 3.5 ATCCGTGCCGTAGCTCCCACTT
Citrobacter koseri ATCC BAA-895 CKO_04874 -185 3.3 TATTTTTCTGTCATTCGCGCAT
-162 3.2 TCATGTTACCTCGCGAGCATAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03813 -88 3.4 TATTTTTCTGTAATTCGAACAT
Enterobacter sp. 638 Ent638_3856 -162 3.5 AGTTATTATTCCCGCCACATTA
-58 3.2 TCATGTTACCTCGCGAGCATAA
Erwinia amylovora ATCC 49946 EAM_3285 -171 3.9 GTGTGTGATGCCGTTAACACAG
Yersinia pestis KIM y0434 -72 3.5 AAAACTGATTTATTTCGCTCAT
-41 4.1 TTTTTTGATGTGAGCCACACAG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2429 -145 3.5 TATCGCGATACAGTTCATCACT
Edwardsiella tarda EIB202 ETAE_3321 -63 3.4 CAATATGTTGTTTATCACTCAA
Position: -38
Score: 3.7
Sequence: CTTTTTTATTGCCTTCAAATAA
Locus tag: ECSE_3786
ECSE_3786 -38 3.7 CTTTTTTATTGCCTTCAAATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: gadB
Ortholog function: Glutamate decarboxylase (EC 4.1.1.15)
Escherichia coli str. K-12 substr. MG1655 b1493 -297 3.6 TTTTATAAATGCGTTCAAAATA
-158 3.3 TATTGTATTGTTTTTCAATGAA
-128 3.3 ATTCGCGTAATATCTCACGATA
Edwardsiella tarda EIB202 ETAE_2868 -186 3.7 TAGCGTTATTTTTCTCATCATT
Position: -155
Score: 4.5
Sequence: TTATGTGAAGCATTTCATAGAA
Position: -82
Score: 3.5
Sequence: TTCCGCGATTTGTTACACATTG
Locus tag: ECSE_3792
ECSE_3792 -155 4.5 TTATGTGAAGCATTTCATAGAA
-82 3.5 TTCCGCGATTTGTTACACATTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: yhjE
Ortholog function: Inner membrane metabolite transport protein YhjE
Escherichia coli str. K-12 substr. MG1655 b3523 -155 4.5 TTATGTGAAGCATTTCATAGAA
Salmonella typhimurium LT2 STM3609 -154 4.2 TTATGTGAAGCATTTCATAGAC
Citrobacter koseri ATCC BAA-895 CKO_04963 -155 4 TTGTGTGAAGCATTTCATAGAC
-94 3.7 TTATTTGAGCGAAATCCCGCTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03874 -154 4.3 TTGTGTGAAGCATTTCATAGAA
Enterobacter sp. 638 Ent638_3920 -155 4.2 AACTGTGAAGCATTTCATAGAA
Erwinia amylovora ATCC 49946 EAM_3376 -134 3.6 AAATATGCCGTATTGAACATTA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0769 -222 4.7 AATTGTGTGCGATCTCACATAT
Position: -143
Score: 4.1
Sequence: TTGTGCGAGCCAGCTCAAACTT
Locus tag: ECSE_3797
ECSE_3797 -143 4.1 TTGTGCGAGCCAGCTCAAACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: dctA
Ortholog function: C4-dicarboxylate transport protein
Escherichia coli str. K-12 substr. MG1655 b3528 -143 4.1 TTGTGCGAGCCAGCTCAAACTT
Salmonella typhimurium LT2 STM3614 -145 4.1 TTGTGCGAGCCAGCTCAAACTT
Citrobacter koseri ATCC BAA-895 CKO_04970 -145 4 TTGTGCGAGCCAGCTCAAAGTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03878 -143 3.9 TTGTGCGAGTCAGCTCAAAGAT
Erwinia amylovora ATCC 49946 EAM_3380 -134 4.4 TGAAGTGATTCAGCTCATAAAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA4362 -157 3.8 TGACGTGATTCAGCTCTTGTTT
Edwardsiella tarda EIB202 ETAE_3379 -155 3.6 TTATGCGTTTCAGCTCATAGAA
Photorhabdus luminescens subsp. laumondii TTO1 plu3205 -176 4.9 TTATGTGATCTATATCTTAAAA
Position: -189
Score: 4.3
Sequence: TTTTGCGATAAACCCCACATTT
Position: -72
Score: 4.4
Sequence: ATTTGAGATTCAACTCTCAAAT
Locus tag: ECSE_3846
ECSE_3846 -189 4.3 TTTTGCGATAAACCCCACATTT
-72 4.4 ATTTGAGATTCAACTCTCAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: bax
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b3570 -189 4.2 TTTTGCGATAACCCCCACATTT
-72 4.4 ATTTGAGATTCAACTCTCAAAT
Salmonella typhimurium LT2 STM3663 -189 4.4 ATTTGCGATAAGCACCACATTT
Enterobacter sp. 638 Ent638_0151 -219 4.2 ATGAGTGATCTCGCGCAAAATT
-189 4.1 ATCTGCGATATCGCACACAATT
-72 4.3 ATTTGAGATTCCGCTCTCAATT
Proteus mirabilis HI4320 PMI2667 -233 4.2 AAATTTGAGTTAAATAGCATTA
Position: -269
Score: 4.2
Sequence: ATTTGAGAGTTGAATCTCAAAT
Position: -152
Score: 4.2
Sequence: AAATGTGGGGTTTATCGCAAAA
Locus tag: ECSE_3847
ECSE_3847 -269 4.2 ATTTGAGAGTTGAATCTCAAAT
-152 4.2 AAATGTGGGGTTTATCGCAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: malS
Ortholog function: periplasmic alpha-amylase precursor
Escherichia coli str. K-12 substr. MG1655 b3571 -269 4.2 ATTTGAGAGTTGAATCTCAAAT
-152 4.1 AAATGTGGGGGTTATCGCAAAA
-118 3.6 TTGCGCGAGATCGCTCACCCTT
Salmonella typhimurium LT2 STM3664 -148 4.5 AAATGTGGTGCTTATCGCAAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03935 -146 3.7 AAATGCTAGCTTCGTCTCATTT
Enterobacter sp. 638 Ent638_0150 -264 4.2 AATTGAGAGCGGAATCTCAAAT
-147 4.1 AATTGTGTGCGATATCGCAGAT
-117 3.8 AATTTTGCGCGAGATCACTCAT
Serratia proteamaculans 568 Spro_0054 -163 4 CATTGTAATATAGATTAAAAAA
Position: -47
Score: 3.7
Sequence: GATCGTGAACTACGGCACACTT
Locus tag: ECSE_3850
ECSE_3850 -47 3.7 GATCGTGAACTACGGCACACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yiaJ
Ortholog function: Hypothetical transcriptional regulator yiaJ, IclR family
Escherichia coli str. K-12 substr. MG1655 b3574 -47 3.7 GATCGTGAACTACGGCACACTT
Salmonella typhimurium LT2 STM3667 -64 4.4 TATCGTGAACTGCAACACACTT
Citrobacter koseri ATCC BAA-895 CKO_05032 -63 3.8 GATCGTGAACTGAAACACACTT
Position: -175
Score: 4.1
Sequence: AAGTGTGCCGTAGTTCACGATC
Locus tag: ECSE_3851
ECSE_3851 -175 4.1 AAGTGTGCCGTAGTTCACGATC
Supported by regulated orthologs from reference regulons
Ortholog gene name: yiaK
Ortholog function: 3-dehydro-L-gulonate 2-dehydrogenase (EC 1.1.1.130)
Escherichia coli str. K-12 substr. MG1655 b3575 -175 4.1 AAGTGTGCCGTAGTTCACGATC
Salmonella typhimurium LT2 STM3668 -187 4.5 AAGTGTGTTGCAGTTCACGATA
Citrobacter koseri ATCC BAA-895 CKO_05033 -177 4.1 AAGTGTGTTTCAGTTCACGATC
Serratia proteamaculans 568 Spro_3933 -182 4.8 AAACGTGTTGTCGATCACAAAT
Position: -4
Score: 3.7
Sequence: ATTCGTGATAGCTGTCGTAAAG
Locus tag: ECSE_3865
ECSE_3865 -4 3.7 ATTCGTGATAGCTGTCGTAAAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: aldB
Ortholog function: Aldehyde dehydrogenase B (EC 1.2.1.22)
Escherichia coli str. K-12 substr. MG1655 b3588 -94 3.7 ATTCGTGATAGCTGTCGTAAAG
Salmonella typhimurium LT2 STM3680 -95 3.7 ATTCGTGATTGCTGTCGTAAAG
Citrobacter koseri ATCC BAA-895 CKO_05043 -94 3.6 TATCGTGACCGCAGTCGTAAAG
Enterobacter sp. 638 Ent638_0143 -93 3.4 ATCCGTGATTCCTGTCGTAAAG
Position: -323
Score: 4.9
Sequence: TCTTGTGATTCAGATCACAAAG
Position: -279
Score: 5.2
Sequence: AAATGTGACACTACTCACATTT
Position: -206
Score: 4.7
Sequence: TTTTGTGATGAGTATCACGTCA
Position: -162
Score: 5.1
Sequence: TTATGTGACTGATATCACACAA
Locus tag: ECSE_3877
ECSE_3877 -323 4.9 TCTTGTGATTCAGATCACAAAG
-279 5.2 AAATGTGACACTACTCACATTT
-206 4.7 TTTTGTGATGAGTATCACGTCA
-162 5.1 TTATGTGACTGATATCACACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mtlA
Ortholog function: PTS system, mannitol-specific IIC component (EC 2.7.1.69) / PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIA component (EC 2.7.1.69)
Escherichia coli str. K-12 substr. MG1655 b3599 -206 4.5 TTTTGTGATGAACGTCACGTCA
-162 5.4 TTATGTGATTGATATCACACAA
-113 3.3 TTCAGTGCCAGATTTCGCAGTA
Salmonella typhimurium LT2 STM3685 -207 4.8 CTTTGTGATCAATATCACATCA
-163 5.4 TTATGTGACGCAAATCACATAA
Citrobacter koseri ATCC BAA-895 CKO_05054 -203 5.2 TTTTGTGATCAATATCACATCA
-159 5 TCATGTGATCCAAATCACACAA
-110 3.4 TTCAGTGCCAGATTTCGCACTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03942 -208 4.9 TTTTGTGATCATCATCACTAAA
-164 5.2 TCATGTGATCCAAATCACATAA
-115 3.4 TTCAGTGCCAGATTTCGCACTA
Enterobacter sp. 638 Ent638_0136 -224 3.4 TATTTTTTTCATACTCTCATTT
-205 4.8 TTTTGTGATGGCGATCACCTCA
-161 5.1 TTGCGTGATGCAGATCACACAA
Erwinia amylovora ATCC 49946 EAM_3416 -229 3.3 CATTGCGAATATCTTTACACTT
-210 3.9 CTTCGTGACTCATGTCACTAAA
-166 4.8 TTAAGTGACCCGCATCACACTT
-95 3.2 CGTTTTGATCGTGATCCCTCAA
-34 3.5 ACATGAGATTTGCATCATTAAT
Yersinia pestis KIM y4087 -223 4.6 AGATGTGATCTTAATCAACAAA
-179 4.5 TTGTGTGACTTTCGTCACGAAA
Serratia proteamaculans 568 Spro_0072 -195 5.2 AAATGTGATGTATATCACTATA
-151 4.5 GTTGGTGATCTGCATCACAAAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0087 -230 5.1 TTTTGTGAAGTAAATCACCTAT
-186 4.5 TTGTGTGATTTTTGTCACGTTG
Position: -58
Score: 4.2
Sequence: AATCGTGACAATACGCACAAAT
Locus tag: ECSE_3927
ECSE_3927 -58 4.2 AATCGTGACAATACGCACAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yicG
Ortholog function: Putative inner membrane protein
Escherichia coli str. K-12 substr. MG1655 b3646 -58 4.4 AATCGTGACAATGCGCACAAAT
Salmonella typhimurium LT2 STM3738 -210 3.7 TTAAATTATCTAAGTCAAAATA
-147 3.8 TTTATTGATATTTATAATAAAT
-58 4.9 AATCGTGATACAGCGCACAAAT
Citrobacter koseri ATCC BAA-895 CKO_05103 -58 4.7 AATCGTGATATTACGCACAAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03994 -55 4.9 AATCGTGATCCTGCGCACAAAT
Enterobacter sp. 638 Ent638_0094 -55 3.9 AATCGTGATATGTTCTGCAAAA
Edwardsiella tarda EIB202 ETAE_0032 -180 3.8 AAAACTAATCTATATCAAATAT
Position: -154
Score: 4.2
Sequence: TTTTGTGATCTAAATTGTAGTA
Locus tag: ECSE_3981
ECSE_3981 -154 4.2 TTTTGTGATCTAAATTGTAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: dgoR
Ortholog function: GntR domain protein
Escherichia coli str. K-12 substr. MG1655 b4479 -154 4.2 TTTTGTGATCTAAATTGTAGTA
Salmonella typhimurium LT2 STM3830 -154 4.2 TTTTGTGATCTAAATTGTAGTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04098 -154 4.1 TTTTGTGATCCAAATTGTAGTA
Enterobacter sp. 638 Ent638_0006 -154 4.2 TTTTGTGATCCAGATTGTAGTA
Serratia proteamaculans 568 Spro_0041 -103 4.2 TTTTGTGATCTTGATTGTAGTA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA4419 -164 4.2 TTTTGTGATCCAGATTGTAGTA
Position: -56
Score: 4.1
Sequence: ATTTTTGAGCGGAATCGCGTTA
Locus tag: ECSE_3983
ECSE_3983 -56 4.1 ATTTTTGAGCGGAATCGCGTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yidA
Ortholog function: Phosphatase YidA
Escherichia coli str. K-12 substr. MG1655 b3697 -56 4.1 ATTTTTGAGCGGAATCGCGTTA
Salmonella typhimurium LT2 STM3831 -56 4.1 TTTTTTGAGCGGAATCGCGTTA
Citrobacter koseri ATCC BAA-895 CKO_00044 -56 4.1 TTTTTTGAGCGGAATCGCGTTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04101 -56 4.1 TTTTTTGAGCGGAATCGCGTTA
Position: -94
Score: 5
Sequence: GATTGTGATTCGATTCACATTT
Locus tag: ECSE_3993
ECSE_3993 -94 5 GATTGTGATTCGATTCACATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: tnaC
Ortholog function: tryptophanase leader peptide
Escherichia coli str. K-12 substr. MG1655 b3707 -94 5 GATTGTGATTCGATTCACATTT
Position: -209
Score: 3.7
Sequence: AACTGCGAGCATGGTCATATTT
Position: -192
Score: 3.6
Sequence: TATTTTTATCAATAGCGCATTG
Locus tag: ECSE_4009
ECSE_4009 -209 3.7 AACTGCGAGCATGGTCATATTT
-192 3.6 TATTTTTATCAATAGCGCATTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: arbG
Ortholog function: transcriptional antiterminator, BglG
Escherichia coli str. K-12 substr. MG1655 b3723 -202 3.7 AACTGCGAGCATGGTCATATTT
-185 3.6 TATTTTTATCAATAGCGCATTG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02579 -154 4.2 AGTCGCGATCTTAATCACGTTT
Enterobacter sp. 638 Ent638_2741 -153 3.9 GATCACGATCTAAATCACATTT
Position: -251
Score: 4.8
Sequence: ATATGTGATCTGAAGCACGCTT
Locus tag: ECSE_4029
ECSE_4029 -251 4.8 ATATGTGATCTGAAGCACGCTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: atpI
Ortholog function: ATP synthase subunit I
Escherichia coli str. K-12 substr. MG1655 b3739 -263 4.8 ATATGTGATCTGAAGCACGCTT
Salmonella typhimurium LT2 STM3872 -262 4.6 ATGTGTGATCTGGTGCACGCTT
-211 4.1 TTTTGTACGATCGTTCACACTT
Citrobacter koseri ATCC BAA-895 CKO_00079 -262 4.7 ATATGTGATCCGAAGCACGCTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04144 -262 4.7 TTATGTGATCTGATGCACGCTT
Enterobacter sp. 638 Ent638_4125 -261 4.8 TTTTGTGATCTCGTGCACGCTT
Erwinia amylovora ATCC 49946 EAM_3481 -264 4.4 ATTTGTGATCGTGGACACGCTT
Yersinia pestis KIM y4142 -263 5.4 TTATGTGATGTATTTCACGTTT
Serratia proteamaculans 568 Spro_0001 -265 4.4 TATTGTGAGCAACTACACGTTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA4519 -254 5 TTATGTGAGTCACATCACAGAT
Edwardsiella tarda EIB202 ETAE_3526 -297 3.7 AATCGTGAAAATATTTAAATTA
Proteus mirabilis HI4320 PMI3057 -259 5 TTGTGTGTTCTAGATCACATTA
Photorhabdus luminescens subsp. laumondii TTO1 plu0047 -265 5.7 TTATGTGATTTAAATCACATTT
Position: -236
Score: 4.2
Sequence: AAACGTGATCAATTTAACACCT
Locus tag: ECSE_4086
ECSE_4086 -236 4.2 AAACGTGATCAATTTAACACCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: hemC
Ortholog function: porphobilinogen deaminase
Escherichia coli str. K-12 substr. MG1655 b3805 -236 4.2 AAACGTGATCAATTTAACACCT
Salmonella typhimurium LT2 STM3938 -219 4.2 AAACGTGATCAATTTAACACCT
Citrobacter koseri ATCC BAA-895 CKO_00147 -220 4.2 AAACGTGATCAATTTAACACCT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04304 -232 4.2 AAACGTGATCAATTTAACACCT
Enterobacter sp. 638 Ent638_3987 -211 4.2 AAACGTGATCAATCTAACACCT
Serratia proteamaculans 568 Spro_0178 -223 4.2 AAACGTGATCAATCTAACACCT
Edwardsiella tarda EIB202 ETAE_0118 -205 4.2 AAACGTGATCAATTTAACACCT
Position: -172
Score: 4
Sequence: AGGTGTTAAATTGATCACGTTT
Locus tag: ECSE_4087
ECSE_4087 -172 4 AGGTGTTAAATTGATCACGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cyaA
Ortholog function: Adenylate cyclase (EC 4.6.1.1)
Escherichia coli str. K-12 substr. MG1655 b3806 -172 4 AGGTGTTAAATTGATCACGTTT
Position: -144
Score: 5.1
Sequence: TTATGTGATTTGAATCACTTTT
Locus tag: ECSE_4119
ECSE_4119 -144 5.1 TTATGTGATTTGAATCACTTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: udp
Ortholog function: Uridine phosphorylase (EC 2.4.2.3)
Escherichia coli str. K-12 substr. MG1655 b3831 -144 5.2 TTATGTGATTTGCATCACTTTT
-92 4.2 CATGGTGATGAGTATCACGAAA
Salmonella typhimurium LT2 STM3968 -144 5.1 TATTGTGATGAACATCACTTTT
-92 4.1 CATAGTGATGGCTGTCACGAAA
Citrobacter koseri ATCC BAA-895 CKO_00173 -143 5.2 TTATGTGATGTAAATCACTATT
-91 3.9 CATGGTGATGAGCGTCACGAAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04327 -143 5.2 TAATGTGATGTGTATCACTATT
-91 4.1 CTTGGTGACTATCATCACAAAA
Enterobacter sp. 638 Ent638_3962 -143 4.7 TAGTGTGATGCATGTCACTATT
Erwinia amylovora ATCC 49946 EAM_0200 -143 4.6 AATTGCGACTTGTATCACCTTT
-90 4 ATTAAGGATGTTCATCACATAA
Yersinia pestis KIM y0444 -149 5.4 ATGTGTGATTTAAATCACAATT
-97 4 CAAGGTGACATAAATCACGAAA
Serratia proteamaculans 568 Spro_0244 -143 5.3 TTTTGTGACTTTAATCACAAAA
-125 3.7 AAAAGTTATGTAGATTGCATTC
-91 4.1 CATAGTGATGGTTGTCACGAAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0185 -197 5.1 AAAAGTGATTTAAGTCACATTT
Edwardsiella tarda EIB202 ETAE_0143 -148 4.7 TATTGTGAAAATAATCACAGTT
Proteus mirabilis HI4320 PMI3532 -145 5.1 ATTTGTGATAACTATCACGTTT
-93 3.6 ACAGGTGACGTCAATCACTAAA
Photorhabdus luminescens subsp. laumondii TTO1 plu4417 -271 5.2 TTTTGTGATTTATATCTCAAAA
-219 4 TGAAGTGACATTTATCACTAAA
Position: -269
Score: 4.2
Sequence: CTTTGTGATCGCTTTCACGGAG
Locus tag: ECSE_4153
ECSE_4153 -269 4.2 CTTTGTGATCGCTTTCACGGAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: glnA
Ortholog function: glutamine synthetase
Escherichia coli str. K-12 substr. MG1655 b3870 -269 4.2 CTTTGTGATCGCTTTCACGGAG
Salmonella typhimurium LT2 STM4007 -272 4.2 CTTTGTGATCGCTTTCACGGAG
-114 3.8 CAATGTGAAAGTTGGCACAGAT
Citrobacter koseri ATCC BAA-895 CKO_03140 -250 4.2 CTTTGTGATCGCTTTCACGGAG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04178 -299 3.9 CTTTGTGACCGCTTTCACGGAG
Serratia proteamaculans 568 Spro_4881 -267 4 GTATGTGATCCCTTTCACGGTG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0029 -265 4.2 CTTTGTGATCCCTTTCACGGTG
Edwardsiella tarda EIB202 ETAE_3493 -267 4.2 GTTTGTGATCCTATTCACGATG
Proteus mirabilis HI4320 PMI2882 -270 4.7 AATTGTGATCCTTTTCACGCCT
-215 3.8 AATTGTGCAACTATTCAGACTT
-181 3.9 ATTTGTGCAATAATTAAAAAAT
Position: -76
Score: 3.6
Sequence: AAAATTGACAGCCGTCACTTTT
Position: 26
Score: 3.7
Sequence: AACCGTGATGGATCGCATCTAT
Locus tag: ECSE_4166
ECSE_4166 -76 3.6 AAAATTGACAGCCGTCACTTTT
26 3.7 AACCGTGATGGATCGCATCTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yihV
Ortholog function: Fructokinase (EC 2.7.1.4); Sugar kinase YihV
Escherichia coli str. K-12 substr. MG1655 b3883 -76 3.6 AAAATTGACAGCCGTCACTTTT
Position: -145
Score: 4.1
Sequence: AGATGTGAAGCAAATCACCCAC
Locus tag: ECSE_4196
ECSE_4196 -145 4.1 AGATGTGAAGCAAATCACCCAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: rhaT
Ortholog function: L-rhamnose-proton symport
Escherichia coli str. K-12 substr. MG1655 b3907 -145 4.1 AGATGTGAAGCAAATCACCCAC
Salmonella typhimurium LT2 STM4050 -293 3.6 TTATGTGACCTCACGCAGCGTT
-149 3.9 AAACGTGAAGTTAATCACTTCA
Citrobacter koseri ATCC BAA-895 CKO_03094 -148 4.1 ATATGTGAGCCAAATCACCCGT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04216 -149 4.7 TTTTGTGATGTAGAACAACTAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0450 -193 3.6 TTTTGTGATCCTGCCTATATCA
Position: -229
Score: 3.6
Sequence: AATCGTGCTGTCGATTAACCTT
Position: -161
Score: 3.8
Sequence: GTGGGTGATTTGCTTCACATCT
Locus tag: ECSE_4197
ECSE_4197 -229 3.6 AATCGTGCTGTCGATTAACCTT
-161 3.8 GTGGGTGATTTGCTTCACATCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: sodA
Ortholog function: Manganese superoxide dismutase (EC 1.15.1.1)
Escherichia coli str. K-12 substr. MG1655 b3908 -161 3.8 GTGGGTGATTTGCTTCACATCT
Citrobacter koseri ATCC BAA-895 CKO_03093 -150 4.4 ACGGGTGATTTGGCTCACATAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04217 -150 4 TTAGTTGTTCTACATCACAAAA
Enterobacter sp. 638 Ent638_4063 -160 3.6 CCGCGTGAGCAGACTCACAATT
Proteus mirabilis HI4320 PMI3036 -292 3.7 TTTTGCGCATAAGATCACGAAA
Photorhabdus luminescens subsp. laumondii TTO1 plu0075 -297 3.7 TTTTGCGCGGAAGATCACGCAA
Position: -142
Score: 4.1
Sequence: TTTTATGACGAAGCACACACAT
Locus tag: ECSE_4216
ECSE_4216 -142 4.1 TTTTATGACGAAGCACACACAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: glpF
Ortholog function: facilitator for glycerol uptake
Escherichia coli str. K-12 substr. MG1655 b3927 -142 4 TTTTATGACGAGGCACACACAT
Position: -128
Score: 3.9
Sequence: AAATTCAATATTCATCACACTT
Locus tag: ECSE_4223
ECSE_4223 -128 3.9 AAATTCAATATTCATCACACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cytR
Ortholog function: transcriptional repressor
Escherichia coli str. K-12 substr. MG1655 b3934 -128 3.9 AAATTCAATATTCATCACACTT
Citrobacter koseri ATCC BAA-895 CKO_03060 -129 3.8 AAATTAAATATCCATCACACTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04229 -162 3.6 TCTTGCGAGCCGGATCGAAAAA
-143 3.9 AAATTTAACAAGCATCACGTTT
Yersinia pestis KIM y0297 -177 3.7 TTCTGCGAGCCAGTTCGAAAAA
-135 3.6 TTATGCAAATTAGGTAACAAAT
Edwardsiella tarda EIB202 ETAE_3434 -258 4.2 AAGTGCGATCGGGATCGAAAAA
-175 3.6 ATATGTGATCATATACTCATCG
Proteus mirabilis HI4320 PMI3218 -207 4.3 TTTTGCGAACTACCTCATAAAA
-189 3.9 AAAAACGATTGGTATCACACTT
Photorhabdus luminescens subsp. laumondii TTO1 plu4760 -213 4.2 ATTTGCGAGCCATATCGAATAA
-195 4.6 ATAAATGATTTATATCACACTT
Position: -147
Score: 4.3
Sequence: AGTTATGAGGCGGATCGCATTT
Locus tag: ECSE_4242
ECSE_4242 -147 4.3 AGTTATGAGGCGGATCGCATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: frwC
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b3949 -202 4 ATTTGCGACGCGTCTCACAAGA
-147 4.3 AGTTATGAGGCGGATCGCATTT
-57 3.9 TATTGTTTCCTCCATCAAAAAT
Salmonella typhimurium LT2 STM4112 -221 4.1 AAATGTAATGTAGCGCAAAAAG
-202 4 AAGTGCGAGTTGTCTCACAACT
-147 4.3 AGTTATGAAGCGGATCGCATTT
Citrobacter koseri ATCC BAA-895 CKO_03045 -202 3.9 AATTGCGAGACACTTCACAAGT
-147 4.3 AGTTATGAGGCGGATCGCATTT
Yersinia pestis KIM y3777 -258 4.5 AATTGGGATATTGCTCACAAAG
Position: -66
Score: 3.7
Sequence: TAGTGTATTTTTATTCATAAAT
Locus tag: ECSE_4250
ECSE_4250 -66 3.7 TAGTGTATTTTTATTCATAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: argE
Ortholog function: acetylornithine deacetylase
Escherichia coli str. K-12 substr. MG1655 b3957 -66 3.7 TAGTGTATTTTTATTCATAAAT
Salmonella typhimurium LT2 STM4120 -66 3.9 TAATGTATTTTTATTCATAATT
Citrobacter koseri ATCC BAA-895 CKO_03037 -27 4.3 TAATGTATTTTTATTCACAAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04246 -27 4 TATTGTATTTTTATTCAAAATA
Enterobacter sp. 638 Ent638_4029 -66 4.2 TAGTGTATTTTTATTCACATTT
Erwinia amylovora ATCC 49946 EAM_0137 -66 3.8 TATTGTATTTTTATTCACTATT
Yersinia pestis KIM y0309 -223 3.6 TATTTTTATTTATGTCAATAAA
Serratia proteamaculans 568 Spro_4782 -71 4.3 TATTGTATTTTTATTCACAATA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0191 -65 4 TATTGTATTTTTATTCAAAATA
Edwardsiella tarda EIB202 ETAE_3483 -65 3.9 TATTGTATTTTTATTCATAATT
Proteus mirabilis HI4320 PMI3236 -65 3.9 TAATGTATTTTTATTCAAAAAA
Photorhabdus luminescens subsp. laumondii TTO1 plu4745 -65 3.9 TAATGTATTTTTATTCAAAAAA
Position: -179
Score: 3.4
Sequence: AAACGTGATTTAACGCCTGATT
Locus tag: ECSE_4288
ECSE_4288 -179 3.4 AAACGTGATTTAACGCCTGATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: hupA
Ortholog function: DNA-binding protein HU-alpha (HU-2)
Escherichia coli str. K-12 substr. MG1655 b4000 -179 3.4 AAACGTGATTTAACGCCTGATT
Citrobacter koseri ATCC BAA-895 CKO_02986 -179 3.4 AAACGTGATTTAACGCCTGATT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04382 -179 3.4 AAACGTGATTTACCGCCTGAAT
Enterobacter sp. 638 Ent638_0213 -179 3.5 AAACGTGATTTAACGCCTGTTT
Yersinia pestis KIM y0499 -181 3.4 AAACGTGATTTAACGCCTGATT
Serratia proteamaculans 568 Spro_0290 -181 3.4 AAACGTGATTTAACGCCTCATT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0238 -197 3.3 AAACGTGATTTAAGGCCTGAAA
Edwardsiella tarda EIB202 ETAE_0183 -182 3.3 AAACGTGATTTAACACCTGATT
Proteus mirabilis HI4320 PMI2771 -183 3.7 AAACGTGATTTAGTGCTTGAAA
Photorhabdus luminescens subsp. laumondii TTO1 plu0492 -179 3.4 AAACGTGATTTAATGCTTTAAA
Position: -117
Score: 3.6
Sequence: AATTGTTTTTGATTTTGCATTT
Locus tag: ECSE_4299
ECSE_4299 -117 3.6 AATTGTTTTTGATTTTGCATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: aceB
Ortholog function: malate synthase A
Escherichia coli str. K-12 substr. MG1655 b4014 -117 3.6 AATTGTTTTTGATTTTGCATTT
Salmonella typhimurium LT2 STM4183 -168 3.3 TTAATTTATATTGTTATCAATA
Citrobacter koseri ATCC BAA-895 CKO_03906 -166 3.3 TATTTTTATTGTTATCAATAAG
Yersinia pestis KIM y0015 -254 3.3 ATGAGTTATAGCCATTAAAAAT
Serratia proteamaculans 568 Spro_4503 -228 3.5 TGTTGTTATGTTTATTAACCAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3991 -185 3.3 TTTTTTAATTTTAATCTTCATT
Proteus mirabilis HI4320 PMI2764 -68 3.7 ATTTTTGATTTTTGTAAAAACT
Photorhabdus luminescens subsp. laumondii TTO1 plu4396 -65 3.8 GTTTTTGATTTATTTTAAATAT
Position: -195
Score: 4.4
Sequence: TTTCGTGATGTTGCTTGCAAAA
Locus tag: ECSE_4325
ECSE_4325 -195 4.4 TTTCGTGATGTTGCTTGCAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: malE
Ortholog function: maltose ABC transporter periplasmic protein
Escherichia coli str. K-12 substr. MG1655 b4034 -195 4.4 TTTCGTGATGTTGCTTGCAAAA
-161 4 TTATGTGCGCATCTCCACATTA
-132 4.3 TTCTGTAACAGAGATCACACAA
Position: -254
Score: 4.4
Sequence: TTGTGTGATCTCTGTTACAGAA
Locus tag: ECSE_4326
ECSE_4326 -254 4.4 TTGTGTGATCTCTGTTACAGAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: malK
Ortholog function: maltose/maltodextrin transporter ATP-binding protein
Escherichia coli str. K-12 substr. MG1655 b4035 -254 4.4 TTGTGTGATCTCTGTTACAGAA
-225 3.9 TAATGTGGAGATGCGCACATAA
-191 3.7 TTTTGCAAGCAACATCACGAAA
Salmonella typhimurium LT2 STM4230 -254 4.7 TTATGTGATCTGTGTTGCATAA
-225 3.6 TAATGCGTGCTGGCGCACACAA
-223 3.8 ATGCGTGCTGGCGCACACAAAA
Citrobacter koseri ATCC BAA-895 CKO_03880 -254 4.7 TTATGTGATCTGTGTTGCATAA
-225 3.7 TAATGCGTGTTGGCGCACATAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04424 -254 4.5 TTGTGTGATCTCCATTGCAAAA
-225 3.7 TATTGCGTCCTGGAGCACAGAA
Photorhabdus luminescens subsp. laumondii TTO1 plu0457 -250 4 GGGTGTGATCTCTATTACAAAA
-221 3.8 AAGCGTGCCGTTGCCCACAAAA
-187 4.9 TTTTGCGATAAATATCACAATT
Position: -130
Score: 3.6
Sequence: CATCCTGCTTTTCATCACAAAA
Position: -57
Score: 4
Sequence: TTTTGCAACAAATCTCACAATA
Position: -4
Score: 3.8
Sequence: AAATATGCGCAAGATCACACAG
Locus tag: ECSE_4349
ECSE_4349 -130 3.6 CATCCTGCTTTTCATCACAAAA
-57 4 TTTTGCAACAAATCTCACAATA
-4 3.8 AAATATGCGCAAGATCACACAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: aphA
Ortholog function: acid phosphatase/phosphotransferase
Escherichia coli str. K-12 substr. MG1655 b4055 -130 3.6 CATCCTGCTTTTCATCACAAAA
-57 4 TTTTGCAACAAATCTCACAATA
Salmonella typhimurium LT2 STM4249 -139 3.7 TGTTGTGATCATCCTCTTTTTT
Citrobacter koseri ATCC BAA-895 CKO_03845 -255 3.9 TATTGTGAATGCGTGTACAGAA
-224 3.7 GTGTGTGTGGTTTATCACACAT
Enterobacter sp. 638 Ent638_0259 -57 3.8 TTTTTTGACCATTCGCTCAATT
Edwardsiella tarda EIB202 ETAE_3469 -150 5 TTTTGTGATGAATGTCACGTAT
-98 3.7 AACATAGATCATGATCACATTA
Proteus mirabilis HI4320 PMI0729 -148 4.3 AAGTGTTAGATAGATCAAAAAA
-87 4.3 TAACGTGCGCTATATCTCATTT
-34 4.3 TTCTGTGATTAATATAAAAATT
Position: -50
Score: 5.7
Sequence: AATTGTGATATAGTTCACAAAA
Locus tag: ECSE_4354
ECSE_4354 -50 5.7 AATTGTGATATAGTTCACAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yjcB
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b4060 -149 5.7 AATTGTGATATAGTTCACAAAA
Salmonella typhimurium LT2 STM4263 -149 5.7 TTTTGTGATATAGTTCACAAAA
Citrobacter koseri ATCC BAA-895 CKO_03830 -150 5.7 TATTGTGATATAGTTCACAAAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04460 -143 5.4 AAGTGTGATATAGTTCACACAA
Enterobacter sp. 638 Ent638_0263 -82 5.3 AAACGTGATATAGTTCACACAT
Serratia proteamaculans 568 Spro_2355 -81 5 CAATGTGACGCAGATCACACTA
Position: -7
Score: 3.9
Sequence: ATCTGTGATGAATGGCACTATT
Locus tag: ECSE_4363
ECSE_4363 -7 3.9 ATCTGTGATGAATGGCACTATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yjcH
Ortholog function: membrane protein
Escherichia coli str. K-12 substr. MG1655 b4068 -100 4.1 TTGCGTGATCTGTCGCCCAAAT
Salmonella typhimurium LT2 STM4274 -100 4.1 TTGCGTGATCTGTCGCCCAAAT
Citrobacter koseri ATCC BAA-895 CKO_03817 -101 4.3 TTGCGTGATCTGCCGCGCAAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04477 -101 3.9 TTGCGTGATCTGCCCCCCAATT
Enterobacter sp. 638 Ent638_0275 -101 4.1 TTGCGTGATCTGTCGCCCAAAT
Erwinia amylovora ATCC 49946 EAM_0326 -98 3.9 CTGCGTGATCTGCCGCGCAAAA
Yersinia pestis KIM y0509 -97 4.2 ATACGTGATCTGCCGCCCAAAA
Serratia proteamaculans 568 Spro_0296 -97 4 TTGCGTGATCTGCCGCCCAAAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0807 -203 5 TATTGTGACATACATCACTTAT
-97 4.1 TTGCGTGATCAATCGCGCAAAA
Proteus mirabilis HI4320 PMI3038 -97 4.5 TTTCGTGATCTTATGCGCAAAA
Photorhabdus luminescens subsp. laumondii TTO1 plu0073 -98 4.2 TTGCGTGATCTTCCGCGCAAAA
Position: -100
Score: 4.1
Sequence: TTGCGTGATCTGTCGCCCAAAT
Locus tag: ECSE_4364
ECSE_4364 -100 4.1 TTGCGTGATCTGTCGCCCAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: acs
Ortholog function: acetyl-coenzyme A synthetase
Escherichia coli str. K-12 substr. MG1655 b4069 -100 4.1 TTGCGTGATCTGTCGCCCAAAT
Salmonella typhimurium LT2 STM4275 -100 4.1 TTGCGTGATCTGTCGCCCAAAT
Citrobacter koseri ATCC BAA-895 CKO_03816 -101 4.3 TTGCGTGATCTGCCGCGCAAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04478 -101 3.9 TTGCGTGATCTGCCCCCCAATT
Enterobacter sp. 638 Ent638_0276 -101 4.1 TTGCGTGATCTGTCGCCCAAAT
Yersinia pestis KIM y0510 -97 4.2 ATACGTGATCTGCCGCCCAAAA
Serratia proteamaculans 568 Spro_0297 -97 4 TTGCGTGATCTGCCGCCCAAAA
Proteus mirabilis HI4320 PMI3037 -97 4.5 TTTCGTGATCTTATGCGCAAAA
Photorhabdus luminescens subsp. laumondii TTO1 plu0074 -98 4.2 TTGCGTGATCTTCCGCGCAAAA
Position: -227
Score: 5.1
Sequence: ATGTGTGAAGTTGATCACAAAT
Locus tag: ECSE_4409
ECSE_4409 -227 5.1 ATGTGTGAAGTTGATCACAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: proP
Ortholog function: L-Proline/Glycine betaine transporter ProP
Escherichia coli str. K-12 substr. MG1655 b4111 -227 5.1 ATGTGTGAAGTTGATCACAAAT
Position: -53
Score: 3.5
Sequence: GACTGTGATCTATTCAGCAAAA
Locus tag: ECSE_4421
ECSE_4421 -53 3.5 GACTGTGATCTATTCAGCAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: dcuB
Ortholog function: C4-dicarboxylate transporter DcuB
Escherichia coli str. K-12 substr. MG1655 b4123 -53 3.5 GACTGTGATCTATTCAGCAAAA
Salmonella typhimurium LT2 STM4301 -53 3.5 GGCTGTGATCCATTTATCAAAA
Citrobacter koseri ATCC BAA-895 CKO_03748 -52 3.9 GACTGTGATCTATTTATCAAAA
Enterobacter sp. 638 Ent638_2479 -81 3.3 AAATCTGATCTGGCTCCCAGCC
Serratia proteamaculans 568 Spro_3863 -77 3.6 GTTTGTGATCGCTATCCCTCAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1533 -296 3.5 TATTGCGAGCGAGATCTTTTAT
-247 3.5 TTAATAGATTTAGATCAAGAAA
Edwardsiella tarda EIB202 ETAE_2844 -194 3.6 ATACTTTATTCAGATCAATTTT
Proteus mirabilis HI4320 PMI0389 -138 3.3 AACTATAACAACGATCAAAAAA
Position: -267
Score: 4
Sequence: TATTGTGGTCATTAGCAAAATT
Position: -206
Score: 4.5
Sequence: AGCGGTGATCTATTTCACAAAT
Position: -156
Score: 4.2
Sequence: TAAAGTGATCCAGATTACGGTA
Locus tag: ECSE_4438
ECSE_4438 -267 4 TATTGTGGTCATTAGCAAAATT
-206 4.5 AGCGGTGATCTATTTCACAAAT
-156 4.2 TAAAGTGATCCAGATTACGGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: aspA
Ortholog function: aspartate ammonia-lyase
Escherichia coli str. K-12 substr. MG1655 b4139 -206 4.5 AGCGGTGATCTATTTCACAAAT
-156 4.2 TAAAGTGATCCAGATTACGGTA
Salmonella typhimurium LT2 STM4326 -209 4.2 AGCGGTGACCTATTTCACAAAA
-159 4.2 TTAAGTGATCCAGATTACGGTA
Citrobacter koseri ATCC BAA-895 CKO_03696 -54 4.2 AGCGGTGACCTATTTCACAAAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04529 -204 3.9 AGCGGTGACCCATTTCACAGAT
-154 3.8 ATAAGTGATCAAGCTTACTGAT
Enterobacter sp. 638 Ent638_0326 -205 4.1 AGCGGTGATTCATTTCACAGAT
Erwinia amylovora ATCC 49946 EAM_0416 -228 4.2 CAATGTGACCTGGAACAGATAT
Yersinia pestis KIM y0606 -224 4.6 AAGTGTGAGAGCAATCACAGAT
Serratia proteamaculans 568 Spro_0406 -205 4.7 AAACGTGAATGAGATCACAGAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0621 -272 4 ACTCGTGACTACAATCACAGTT
Edwardsiella tarda EIB202 ETAE_0311 -197 4.4 ATCTGTGAGTATTATCACAGAT
Proteus mirabilis HI4320 PMI2546 -206 4.1 ATCCATGAGATAGATCACAAAA
Photorhabdus luminescens subsp. laumondii TTO1 plu4137 -274 3.8 AGATATAATTGGGGTCACAGTT
-211 5.6 AATTGTGATAAATATCACATAT
Position: -202
Score: 4.1
Sequence: TACCGTAATCTGGATCACTTTA
Position: -152
Score: 4.3
Sequence: ATTTGTGAAATAGATCACCGCT
Position: -91
Score: 3.9
Sequence: AATTTTGCTAATGACCACAATA
Locus tag: ECSE_4439
ECSE_4439 -202 4.1 TACCGTAATCTGGATCACTTTA
-152 4.3 ATTTGTGAAATAGATCACCGCT
-91 3.9 AATTTTGCTAATGACCACAATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: fxsA
Ortholog function: suppressor of F plamsid exlusion of phage T7
Escherichia coli str. K-12 substr. MG1655 b4140 -202 4.1 TACCGTAATCTGGATCACTTTA
-152 4.3 ATTTGTGAAATAGATCACCGCT
Salmonella typhimurium LT2 STM4327 -203 4.1 TACCGTAATCTGGATCACTTAA
-153 4.1 TTTTGTGAAATAGGTCACCGCT
Citrobacter koseri ATCC BAA-895 CKO_03695 -156 4.1 TTTTGTGAAATAGGTCACCGCT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04530 -140 3.7 ATCTGTGAAATGGGTCACCGCT
Enterobacter sp. 638 Ent638_0327 -151 3.8 ATCTGTGAAATGAATCACCGCT
Erwinia amylovora ATCC 49946 EAM_0417 -161 3.9 ATATCTGTTCCAGGTCACATTG
Yersinia pestis KIM y0607 -245 4.8 ATCTGTGATTGCTCTCACACTT
Serratia proteamaculans 568 Spro_0407 -117 4.9 TTCTGTGATCTCATTCACGTTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0623 -245 3.7 AACTGTGATTGTAGTCACGAGT
-185 3.6 AAATGTGCAAAGGCGCACCCAT
Edwardsiella tarda EIB202 ETAE_0312 -189 4.6 ATCTGTGATAATACTCACAGAT
Proteus mirabilis HI4320 PMI2545 -188 4.7 TTTTGTGATCTATCTCATGGAT
Photorhabdus luminescens subsp. laumondii TTO1 plu4136 -188 5.6 ATATGTGATATTTATCACAATT
Position: -146
Score: 3.7
Sequence: ATGTGTAATTCAATTAACTAAA
Position: -67
Score: 3.8
Sequence: ATTTGCGGGTCGCGTCACATTT
Position: -30
Score: 3.8
Sequence: TGTTGTGATTACTTTTGAAAAT
Locus tag: ECSE_4491
ECSE_4491 -146 3.7 ATGTGTAATTCAATTAACTAAA
-67 3.8 ATTTGCGGGTCGCGTCACATTT
-30 3.8 TGTTGTGATTACTTTTGAAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ulaA
Ortholog function: Ascorbate-specific PTS system, EIIC component
Escherichia coli str. K-12 substr. MG1655 b4193 -124 3.8 ATTTGCGGGTCGCGTCACATTT
-87 3.8 TGTTGTGATTACTTTTGAAAAT
Salmonella typhimurium LT2 STM4383.S -122 3.9 ATTTGCGCGCTACGTCACAGTT
-85 3.8 TGTTGTGATTACTTTTGAAAAT
Citrobacter koseri ATCC BAA-895 CKO_03643 -124 3.9 ATTTGCGTGGTGCGTCACAATT
-87 3.8 TGTTGTGATTACTTTTGAAAAT
Position: -198
Score: 4.7
Sequence: TTTTGTGAGCTGTTTCGCGTTA
Locus tag: ECSE_4514
ECSE_4514 -198 4.7 TTTTGTGAGCTGTTTCGCGTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: cycA2
Ortholog function: D-alanine/D-serine/glycine permease
Escherichia coli str. K-12 substr. MG1655 b4208 -198 4.7 TTTTGTGAGCTGTTTCGCGTTA
Salmonella typhimurium LT2 STM4398 -193 5.1 TTTTGTGAGCTAATTCGCATTA
-170 3.9 CAAAGTGATATAACACTCATTT
Citrobacter koseri ATCC BAA-895 CKO_03624 -199 4.4 TTTTGTGAGCTAATTCGCGTTG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04601 -192 4.7 TTTTGTGAGCTATTTCGCGTTA
-169 3.8 ATGAGTGATATAACACTCACTT
Enterobacter sp. 638 Ent638_0378 -201 4.2 TTTTGTGAGCTGTTTTGCATTG
Yersinia pestis KIM y2447 -199 4.5 CACTGTGATGTACTTAACAAAA
-118 3.7 TAATATTAAATTATTCGCAAAT
Proteus mirabilis HI4320 PMI1614 -102 4.4 TTCTGAGATTTGTGTCACAATA
Photorhabdus luminescens subsp. laumondii TTO1 plu1965 -102 4.6 TATAGTAATCTGTGTCACAATA
Position: -118
Score: 3.8
Sequence: AACTGTGATAGTGTCATCATTT
Position: -85
Score: 3.8
Sequence: AATTGTGGCATTCTTCACTGTT
Locus tag: ECSE_4519
ECSE_4519 -118 3.8 AACTGTGATAGTGTCATCATTT
-85 3.8 AATTGTGGCATTCTTCACTGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cpdB
Ortholog function: 2',3'-cyclic-nucleotide 2'-phosphodiesterase precursor
Escherichia coli str. K-12 substr. MG1655 b4213 -118 3.8 AACTGTGATAGTGTCATCATTT
-85 3.8 AATTGTGGCATTCTTCACTGTT
Salmonella typhimurium LT2 STM4403 -145 3.7 TTCTGTGAACACTCGCAAAAAA
Citrobacter koseri ATCC BAA-895 CKO_03616 -25 4.2 TTTTGTGTTTCAGATCTAAAAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04607 -156 3.8 TTGTTTTATTTATATCGCATCA
-87 3.7 TTTTCTGGCAAGATTCACATTT
-35 4.2 TTCTGTGCTATCGCTCATAAAA
Enterobacter sp. 638 Ent638_0392 -34 4 TTTTGTGGCTTGGATCGAAAAA
Yersinia pestis KIM y0653 -148 3.6 AACTGTGAGCGTCTACGCGTTA
-116 3.8 TTTTCTGCCAAACTTCACACTT
-63 4.4 TTTTGCGATACATATCGAATAT
Serratia proteamaculans 568 Spro_0453 -95 3.8 TTTTCTGCCACACTTCACAGTT
Position: -126
Score: 3.6
Sequence: AACAGTGAAGAATGCCACAATT
Locus tag: ECSE_4520
ECSE_4520 -126 3.6 AACAGTGAAGAATGCCACAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cysQ
Ortholog function: PAPS (adenosine 3'-phosphate 5'-phosphosulfate) 3'(2'),5'-bisphosphate nucleotidase
Escherichia coli str. K-12 substr. MG1655 b4214 -126 3.6 AACAGTGAAGAATGCCACAATT
Salmonella typhimurium LT2 STM4404 -144 3.9 TTTTTTGCGAGTGTTCACAGAA
Citrobacter koseri ATCC BAA-895 CKO_03615 -178 4.1 TTTTTAGATCTGAAACACAAAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04608 -178 4.1 TTTTATGAGCGATAGCACAGAA
-126 3.7 AAATGTGAATCTTGCCAGAAAA
-57 3.9 TGATGCGATATAAATAAAACAA
Enterobacter sp. 638 Ent638_0393 -167 3.9 TTTTTCGATCCAAGCCACAAAA
Erwinia amylovora ATCC 49946 EAM_0455 -158 4.2 AAATGTGACACAGCACGAATAA
Serratia proteamaculans 568 Spro_0454 -180 3.7 AACTGTGAAGTGTGGCAGAAAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3601 -258 3.7 TAAAGTGATTATCGTCTCTAAA
Position: -163
Score: 3.9
Sequence: TTTTTTAATCTGCCGCTCATTT
Locus tag: ECSE_4537
ECSE_4537 -163 3.9 TTTTTTAATCTGCCGCTCATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: fbp
Ortholog function: fructose-1,6-bisphosphatase
Escherichia coli str. K-12 substr. MG1655 b4232 -163 3.9 TTTTTTAATCTGCCGCTCATTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04626 -164 3.9 TTTTCTTATCCGGGGCACATTT
Edwardsiella tarda EIB202 ETAE_0381 -150 3.9 TGCATTGATTTAGTTCACATTC
Position: -101
Score: 3.8
Sequence: AATTGTGATCTTCGCTGCGTTT
Locus tag: ECSE_4545
ECSE_4545 -101 3.8 AATTGTGATCTTCGCTGCGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: treB
Ortholog function: PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component (EC 2.7.1.69)
Escherichia coli str. K-12 substr. MG1655 b4240 -101 3.8 AATTGTGATCTTCGCTGCGTTT
Citrobacter koseri ATCC BAA-895 CKO_03571 -156 3.8 ATTTGTGATCTTCGCTGCGTTT
Enterobacter sp. 638 Ent638_0439 -106 4 TATTGTGATCTTCACCCGATTT
Serratia proteamaculans 568 Spro_0529 -124 3.8 TTTTGTGATCCTCGCCCCAAAC
Photorhabdus luminescens subsp. laumondii TTO1 plu3288 -127 4.3 CAATGTGATCTTCAACCCATTT
Position: -186
Score: 4.5
Sequence: TCTTGTGATGTGGTTAACCAAT
Locus tag: ECSE_4595
ECSE_4595 -186 4.5 TCTTGTGATGTGGTTAACCAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: uxuA
Ortholog function: Mannonate dehydratase (EC 4.2.1.8)
Escherichia coli str. K-12 substr. MG1655 b4322 -271 3.8 TGTTGCGATGAATGTCACATCC
-186 4.5 TCTTGTGATGTGGTTAACCAAT
Salmonella typhimurium LT2 STM3135 -205 4.3 AAAATTGACACAGATCAAATAA
-155 4.6 ATTTGTGATTTGGTTAGCCAAT
Citrobacter koseri ATCC BAA-895 CKO_00609 -115 3.9 GATTGTGAGCTGGATCAATCAA
Enterobacter sp. 638 Ent638_2767 -116 3.9 TTCTGTGAGTTGGATCAATCAA
Serratia proteamaculans 568 Spro_3238 -167 3.9 AACCGTGAAGTGGATCAACCAA
-48 4.1 AATCTTGATCACCACCACAATA
Edwardsiella tarda EIB202