Orthologous regulated operons containing yhcR gene

Properties
Regulog:	Crp - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria/gamma

Built upon 2301 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -168 Score: 5.43581 Sequence: AAAAGTGATTTAGATCACATAT Locus tag: CKO_04650 Name: yhcR Funciton: hypothetical protein
yhcR	-168	5.4	AAAAGTGATTTAGATCACATAT	CKO_04650
Enterobacter sp. 638
Position: -165 Score: 5.43581 Sequence: AAAAGTGATTTAGATCACATAT Locus tag: Ent638_3679 Name: yhcR Funciton: hypothetical protein Locus tag: Ent638_3678 Name: aaeA Funciton: p-hydroxybenzoic acid efflux system component Locus tag: Ent638_3677 Name: aaeB Funciton: p-hydroxybenzoic acid efflux system component
yhcR-aaeA-aaeB	-165	5.4	AAAAGTGATTTAGATCACATAT	Ent638_3679
Escherichia coli str. K-12 substr. MG1655
Position: -167 Score: 5.40733 Sequence: AAAAGTGATTTAGATCACATAA Locus tag: b3242 Name: yhcR Funciton: hypothetical protein Locus tag: b3241 Name: aaeA Funciton: p-hydroxybenzoic acid efflux system component Locus tag: b3240 Name: aaeB Funciton: p-hydroxybenzoic acid efflux system component
yhcR-aaeA-aaeB	-167	5.4	AAAAGTGATTTAGATCACATAA	b3242
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -116 Score: 5.23826 Sequence: AAAAGTGATTTAGATCACACAT Position: -63 Score: 3.74289 Sequence: TATTGTTAGCTACATAATAAAC Locus tag: KPN_03651 Name: yhcR Funciton: hypothetical protein Locus tag: KPN_03650 Name: aaeA Funciton: p-hydroxybenzoic acid efflux system component Locus tag: KPN_03649 Name: aaeB Funciton: p-hydroxybenzoic acid efflux system component
yhcR-aaeA-aaeB	-116	5.2	AAAAGTGATTTAGATCACACAT	KPN_03651
	-63	3.7	TATTGTTAGCTACATAATAAAC
Salmonella typhimurium LT2
Position: -166 Score: 5.40733 Sequence: AAAAGTGATTTAGATCACATAA Locus tag: STM3366 Name: yhcR Funciton: hypothetical protein Locus tag: STM3365 Name: aaeA Funciton: p-hydroxybenzoic acid efflux system component Locus tag: STM3364 Name: aaeB Funciton: p-hydroxybenzoic acid efflux system component
yhcR-aaeA-aaeB	-166	5.4	AAAAGTGATTTAGATCACATAA	STM3366
Serratia proteamaculans 568
Position: -293 Score: 5.13311 Sequence: AAAAGTGATTTAGATCACAGAT Position: -89 Score: 3.75463 Sequence: ATTTGTGGTGCGTGTCAGCTAA Locus tag: Spro_4392 Name: yhcR Funciton: hypothetical protein Locus tag: Spro_4391 Name: aaeA Funciton: p-hydroxybenzoic acid efflux system component Locus tag: Spro_4390 Name: aaeB Funciton: p-hydroxybenzoic acid efflux system component
yhcR-aaeA-aaeB	-293	5.1	AAAAGTGATTTAGATCACAGAT	Spro_4392
	-89	3.8	ATTTGTGGTGCGTGTCAGCTAA
Yersinia pestis KIM
Position: -269 Score: 5.23826 Sequence: AAAAGTGATTTAGATCACACAT Locus tag: y0179 Name: yhcR Funciton: hypothetical protein Locus tag: y0178 Name: aaeA Funciton: p-hydroxybenzoic acid efflux system component Locus tag: y0177 Name: aaeB Funciton: p-hydroxybenzoic acid efflux system component
yhcR-aaeA-aaeB	-269	5.2	AAAAGTGATTTAGATCACACAT	y0179

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing yhcR gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --