Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of GalR/GalS regulog to Dickeya dadantii Ech586

Reference regulog properties
Source regulog: GalR/GalS - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor (activator)
Biological process: Galactose utilization
Effector: Galactose
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Dickeya dadantii Ech586
Orthologous TF(s) Dd586_1106, Dd586_3403
Regulated genes 1
Built upon 78 sites [see more]
Predicted regulatory interactions in Dickeya dadantii Ech586
Locus tag Position Score Sequence
Position: -126
Score: 5.3
Sequence: GTATGTAACCGCTTTCATCA
Locus tag: Dd586_1106
Dd586_1106 -126 5.3 GTATGTAACCGCTTTCATCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: galS
Ortholog function: galactose operon repressor galS
Escherichia coli str. K-12 substr. MG1655 b2151 -113 5.5 GGCTGTAACCGTTTCCATTG
Salmonella typhimurium LT2 STM2191 -121 5.4 GGCTGTAACCGTTTCCATCC
Citrobacter koseri ATCC BAA-895 CKO_00640 -124 4.9 GCATGTAACCGTTTCCAGCC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02589 -127 5.2 GGATGTAAACGTTTCCAGCC
Enterobacter sp. 638 Ent638_2751 -127 5.5 GGATGTAACCGTTTTCATCT
Erwinia amylovora ATCC 49946 EAM_2208 -128 4.9 GGCTGTAACCGTTTTCATGG
Serratia proteamaculans 568 Spro_1562 -102 5.4 GTATGTAAACGTTTTCTTTC