Propagation of CueR regulog to Salmonella enterica subsp. enterica serovar Typhi str. M223
Source regulog: | CueR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | MerR |
Regulation mode: | activator (repressor) |
Biological process: | Copper resistance |
Effector: | Copper ion, (Cu+) |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Salmonella enterica subsp. enterica serovar Typhi str. M223 |
Orthologous TF(s) | SentesT_010100024035, SentesT_010100025692 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -62
Score: 6.5 Sequence: ACCTTCCCGTTAGGGCAGGGT
Locus tag: SentesT_010100025794
|
||||
SentesT_010100025794 | -62 | 6.5 | ACCTTCCCGTTAGGGCAGGGT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: cueO | ||||
Ortholog function: Multicopper oxidase | ||||
Escherichia coli str. K-12 substr. MG1655 | b0123 | -73 | 6.4 | ACCTTCCCGTAAGGGGAAGGA |
Salmonella typhimurium LT2 | STM0168 | -62 | 6.5 | ACCTTCCCGTTAGGGCAGGGT |
Citrobacter koseri ATCC BAA-895 | CKO_03244 | -73 | 6.7 | ACCTTCCCGTAAGGGGAGGGT |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_00131 | -62 | 6.4 | ACCTTCCCGTTACGGTAGGGT |
Erwinia amylovora ATCC 49946 | EAM_0777 | -62 | 6.2 | ACCTTCCCGCTGGGGCAGGGT |
Yersinia pestis KIM | y0777 | -210 | 6.4 | ACCTTCCCCTAAGAGGAGGGT |
Serratia proteamaculans 568 | Spro_3999 | -118 | 6.3 | ACCTTCCGCTAAGGGGAGGGT |
Proteus mirabilis HI4320 | PMI0159 | -108 | 5.6 | ACCTTCCAGTAAGGGGAGACT |