Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of GalR/GalS regulog to Salmonella enterica subsp. enterica serovar Typhi str. AG3

Reference regulog properties
Source regulog: GalR/GalS - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor (activator)
Biological process: Galactose utilization
Effector: Galactose
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Typhi str. AG3
Orthologous TF(s) Salmonellaentericaenterica_010100042678, Salmonellaentericaenterica_010100018077, Salmonellaentericaenterica_010100048226, Salmonellaentericaenterica_010100033102, Salmonellaentericaenterica_010100024024
Regulated genes 2
Built upon 78 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Typhi str. AG3
Locus tag Position Score Sequence
Position: -121
Score: 5.4
Sequence: GGCTGTAACCGTTTCCATCC
Locus tag: Salmonellaentericaenterica_010100018077
Salmonellaentericaenterica_010100018077 -121 5.4 GGCTGTAACCGTTTCCATCC
Supported by regulated orthologs from reference regulons
Ortholog gene name: galS
Ortholog function: galactose operon repressor galS
Escherichia coli str. K-12 substr. MG1655 b2151 -113 5.5 GGCTGTAACCGTTTCCATTG
Salmonella typhimurium LT2 STM2191 -121 5.4 GGCTGTAACCGTTTCCATCC
Citrobacter koseri ATCC BAA-895 CKO_00640 -124 4.9 GCATGTAACCGTTTCCAGCC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02589 -127 5.2 GGATGTAAACGTTTCCAGCC
Enterobacter sp. 638 Ent638_2751 -127 5.5 GGATGTAACCGTTTTCATCT
Erwinia amylovora ATCC 49946 EAM_2208 -128 4.9 GGCTGTAACCGTTTTCATGG
Serratia proteamaculans 568 Spro_1562 -102 5.4 GTATGTAAACGTTTTCTTTC
Position: -33
Score: 5.3
Sequence: TAATGTAAGCGTTTACCCAC
Locus tag: Salmonellaentericaenterica_010100048226
Salmonellaentericaenterica_010100048226 -33 5.3 TAATGTAAGCGTTTACCCAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: galR
Ortholog function: galactose operon repressor galR
Escherichia coli str. K-12 substr. MG1655 b2837 -32 5.2 GAATGTAAGCGTTTACCCAC
Salmonella typhimurium LT2 STM3011 -33 5.3 TAATGTAAGCGTTTACCCAC
Citrobacter koseri ATCC BAA-895 CKO_04211 -33 5.1 AAATGTAAGCGTTTACCCAC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03246 -33 5.5 GTATGTAAACGCTTACCCTA
Enterobacter sp. 638 Ent638_3278 -35 5.3 GTGTGTAAACGCTTACCCCC
Erwinia amylovora ATCC 49946 EAM_2770 -35 4.9 AAATGTAAACGCTTACCCAG
Yersinia pestis KIM y3183 32 5.4 TGATGTAAGCGGTTACCCTA
Serratia proteamaculans 568 Spro_3832 -34 5.2 GAATGTAAGCGATTACCCAG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3172 -240 5.3 AAGTGTAATCGGTTACCCTA
Edwardsiella tarda EIB202 ETAE_2890 -41 5.2 TGGTGTAAACGTTTACGGTT
© 2009-2020 RegPrecise