Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of KdgR regulog to Salmonella enterica subsp. enterica serovar Typhi str. AG3

Reference regulog properties
Source regulog: KdgR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor (activator)
Biological process: Pectin and polygalacturonate utlization
Effector: 2-keto-3-deoxygluconate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Typhi str. AG3
Orthologous TF(s) Salmonellaentericaenterica_010100036808, Salmonellaentericaenterica_010100036813
Regulated genes 6
Built upon 159 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Typhi str. AG3
Locus tag Position Score Sequence
Position: -231
Score: 5.4
Sequence: TTATGAAACATTGTTTCAGAT
Locus tag: Salmonellaentericaenterica_010100001644
Salmonellaentericaenterica_010100001644 -231 5.4 TTATGAAACATTGTTTCAGAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: tpfX
Ortholog function: ThiJ/PfpI-family hypothetical protein
Salmonella typhimurium LT2 STM1931 -231 5.4 TTATGAAACATTGTTTCAGAT
Citrobacter koseri ATCC BAA-895 CKO_01049 -199 5.4 TTTTGAAATGATGTTTCATAT
Enterobacter sp. 638 Ent638_2477 -42 5 GGATGAAACGCTGTTTTAAAT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0102 -85 6.1 TAATAAAACATCGTTTCATTT
Position: -132
Score: 4.9
Sequence: AAATGAAACACACTTTTCATT
Locus tag: Salmonellaentericaenterica_010100009233
Salmonellaentericaenterica_010100009233 -132 4.9 AAATGAAACACACTTTTCATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ppsR
Ortholog function: PEP synthetase regulatory protein
Escherichia coli str. K-12 substr. MG1655 b1703 -131 5.3 AAATGAAATGCTGTTTTCATA
Salmonella typhimurium LT2 STM1348 -131 4.9 AAATGAAACACACTTTTCATT
Citrobacter koseri ATCC BAA-895 CKO_01727 -107 5.5 TATAAAAATAGCGTTTCATTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02161 -97 5.1 AACAAAAATAGCGTTTCAATT
Enterobacter sp. 638 Ent638_1744 -107 5.3 ATTAAAAACACCATTTCATTT
Serratia proteamaculans 568 Spro_2173 -134 5.2 ATTTGAAATAGTGTTTTACTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1852 -94 5.6 TAATGAAATGGCGTTTTAATA
Position: -123
Score: 6.2
Sequence: AAATGAAACGTTGTTTTATTT
Locus tag: Salmonellaentericaenterica_010100014734
Salmonellaentericaenterica_010100014734 -123 6.2 AAATGAAACGTTGTTTTATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: kduI
Ortholog function: 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
Escherichia coli str. K-12 substr. MG1655 b2843 -130 6.3 AAATGAAACATTGTTTTATTT
-63 5.4 AAACGAAACAGTGTTTCACTA
Salmonella typhimurium LT2 STM3018 -123 6.2 AAATGAAACGTTGTTTTATTT
-58 5.3 AATCAAAACAGTGTTTTGATT
Citrobacter koseri ATCC BAA-895 CKO_04220 -119 6.2 AAATGAAACAACGTTTTATTT
-51 4.4 AAACGGAACGGTGTTTCGCCT
Enterobacter sp. 638 Ent638_3296 -127 5.4 AACTGAAACAACGTTTTAAAT
-60 5 AATCGGAACATTGTTTCGTTA
Yersinia pestis KIM y1887 -201 6 TAATAAAACATCATTTCATTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2400 -209 6.1 AAATAAAACATTATTTCATTT
Edwardsiella tarda EIB202 ETAE_1898 -129 5.6 AATCAAAACAGCATTTCATTT
Position: -32
Score: 5.7
Sequence: AAATAAAACGCTGTTTTAACT
Locus tag: Salmonellaentericaenterica_010100042698
Salmonellaentericaenterica_010100042698 -32 5.7 AAATAAAACGCTGTTTTAACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yjgK
Ortholog function: cytoplasmic protein involved in polygalacturonate utilization
Escherichia coli str. K-12 substr. MG1655 b4252 -35 6 AAATGAAACGTTGTTTTAATT
Salmonella typhimurium LT2 STM4468 -32 5.7 AAATAAAACGCTGTTTTAACT
Citrobacter koseri ATCC BAA-895 CKO_03553 -33 6.2 AAATGAAACGTTGTTTTATTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04658 -33 5.8 AAATGAAATGCTGTTTTATAT
Enterobacter sp. 638 Ent638_0453 -34 6 AAATGAAACATTGTTTTATAT
Yersinia pestis KIM y0739 -41 5.9 TAATAAAACAGCATTTCATTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0383 -41 5.1 TTGTAAAACAGGGTTTCATTT
Edwardsiella tarda EIB202 ETAE_3112 -39 5.6 AAATAAAACGCAGTTTTATAA
Position: -229
Score: 5.8
Sequence: AAATAAAACATTATTTTAATT
Locus tag: Salmonellaentericaenterica_010100047042
Salmonellaentericaenterica_010100047042 -229 5.8 AAATAAAACATTATTTTAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: kdgX
Ortholog function: predicted 2-keto-3-deoxygluconate permease
Salmonella typhimurium LT2 STM4395 -34 5.8 AAATAAAACATTATTTTAATT
Citrobacter koseri ATCC BAA-895 CKO_03627 -31 5.2 AAATAAAACATTATTTCAAAG
Enterobacter sp. 638 Ent638_0375 -33 5.9 AATTGAAACGTCATTTTATTT
Yersinia pestis KIM y1734 -22 5.8 TAACGAAACATCATTTCATTT
Position: -120
Score: 5.1
Sequence: AACAGAAACAATGTTTCATTC
Locus tag: Salmonellaentericaenterica_010100052115
Salmonellaentericaenterica_010100052115 -120 5.1 AACAGAAACAATGTTTCATTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: yjcB
Ortholog function: putative inner membrane protein
Salmonella typhimurium LT2 STM4263 -120 5.4 AATAGAAACAATGTTTCATTC
Citrobacter koseri ATCC BAA-895 CKO_03830 -121 5.1 AACAGAAACGTTGTTTCATTC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04460 -113 4.9 AACAGAAATGGCGTTTCATCA