Propagation of QorR regulog to Salmonella enterica subsp. enterica serovar Typhi str. E98-3139

Reference regulog properties
Source regulog:	QorR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	HxlR
Regulation mode:	repressor
Biological process:	Energy metabolism
Effector:
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar Typhi str. E98-3139
Orthologous TF(s)	Salmonellentericaenterica_010100024925
Regulated genes	1

Built upon 15 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar Typhi str. E98-3139*
	Locus tag	Position	Score	Sequence
Position: -41 Score: 6.6 Sequence: AAACTTACTTTTAGTAAGTAC Locus tag: Salmonellentericaenterica_010100024925
	Salmonellentericaenterica_010100024925	-41	6.6	AAACTTACTTTTAGTAAGTAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: qorR
Ortholog function: Redox-sensing transcriptional regulator QorR, HxlR family
Citrobacter koseri ATCC BAA-895	CKO_03617	-43	6.6	AAACTTACTTTTAGTAAGTAC
Enterobacter sp. 638	Ent638_0384	-37	6.3	TAACTAACTTATAGTAAGTAC
Erwinia carotovora subsp. atroseptica SCRI1043	ECA4450	-40	6.1	AAGCTAACTTTAAGTAAGTAC
Escherichia coli str. K-12 substr. MG1655	b4212	-42	6.6	AAACTTACTTTTAGTAAGTAC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_04606	-42	6.3	TAACTAACTTTTAGTAAGTAC
Proteus mirabilis HI4320	PMI0975	-42	6.6	AAACTTACTAAAAGTAAGTAC
Salmonella typhimurium LT2	STM4402	-41	6.6	AAACTTACTTTTAGTAAGTAC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --