Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of QorR regulog to Salmonella enterica subsp. enterica serovar Typhi str. E98-3139

Reference regulog properties
Source regulog: QorR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: HxlR
Regulation mode: repressor
Biological process: Energy metabolism
Effector:
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Typhi str. E98-3139
Orthologous TF(s) Salmonellentericaenterica_010100024925
Regulated genes 1
Built upon 15 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Typhi str. E98-3139
Locus tag Position Score Sequence
Position: -41
Score: 6.6
Sequence: AAACTTACTTTTAGTAAGTAC
Locus tag: Salmonellentericaenterica_010100024925
Salmonellentericaenterica_010100024925 -41 6.6 AAACTTACTTTTAGTAAGTAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: qorR
Ortholog function: Redox-sensing transcriptional regulator QorR, HxlR family
Citrobacter koseri ATCC BAA-895 CKO_03617 -43 6.6 AAACTTACTTTTAGTAAGTAC
Enterobacter sp. 638 Ent638_0384 -37 6.3 TAACTAACTTATAGTAAGTAC
Erwinia carotovora subsp. atroseptica SCRI1043 ECA4450 -40 6.1 AAGCTAACTTTAAGTAAGTAC
Escherichia coli str. K-12 substr. MG1655 b4212 -42 6.6 AAACTTACTTTTAGTAAGTAC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04606 -42 6.3 TAACTAACTTTTAGTAAGTAC
Proteus mirabilis HI4320 PMI0975 -42 6.6 AAACTTACTAAAAGTAAGTAC
Salmonella typhimurium LT2 STM4402 -41 6.6 AAACTTACTTTTAGTAAGTAC