Regulog QorR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | HxlR |
| Regulation mode: | repressor |
| Biological process: | Energy metabolism |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By trascription factor - QorR
- By TF family - HxlR
- By pathway - Energy metabolism
| Genome | Genes | Operons |
|---|---|---|
| Citrobacter koseri ATCC BAA-895 | 2 | 2 |
| Edwardsiella tarda EIB202 | ||
| Enterobacter sp. 638 | 2 | 2 |
| Erwinia amylovora ATCC 49946 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | 2 | 2 |
| Escherichia coli str. K-12 substr. MG1655 | 2 | 2 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 2 | 2 |
| Photorhabdus luminescens subsp. laumondii TTO1 | ||
| Proteus mirabilis HI4320 | 2 | 2 |
| Salmonella typhimurium LT2 | 2 | 2 |
| Serratia proteamaculans 568 | ||
| Yersinia pestis KIM | 1 | 1 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| qorR |
*
Citrobacter koseri ATCC BAA-895 Site: position = -43 score = 6.59987 sequence = AAACTTACTTTTAGTAAGTAC Gene: CKO_03617: Redox-sensing transcriptional regulator QorR, HxlR family |
|
*
Enterobacter sp. 638 Site: position = -37 score = 6.28035 sequence = TAACTAACTTATAGTAAGTAC Gene: Ent638_0384: Redox-sensing transcriptional regulator QorR, HxlR family |
|
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -40 score = 6.12513 sequence = AAGCTAACTTTAAGTAAGTAC Gene: ECA4450: Redox-sensing transcriptional regulator QorR, HxlR family |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -42 score = 6.59987 sequence = AAACTTACTTTTAGTAAGTAC Gene: b4212: Redox-sensing transcriptional regulator QorR, HxlR family |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -42 score = 6.28035 sequence = TAACTAACTTTTAGTAAGTAC Gene: KPN_04606: Redox-sensing transcriptional regulator QorR, HxlR family |
|
*
Proteus mirabilis HI4320 Site: position = -42 score = 6.59987 sequence = AAACTTACTAAAAGTAAGTAC Gene: PMI0975: Redox-sensing transcriptional regulator QorR, HxlR family |
*
Salmonella typhimurium LT2 Site: position = -41 score = 6.59987 sequence = AAACTTACTTTTAGTAAGTAC Gene: STM4402: Redox-sensing transcriptional regulator QorR, HxlR family |
|
Gene: y1807: Redox-sensing transcriptional regulator QorR, HxlR family |
Redox-sensing transcriptional regulator QorR, HxlR family |
| CRON 2. | |||||||||||||
| qorB |
*
Citrobacter koseri ATCC BAA-895 Site: position = -34 score = 6.59987 sequence = GTACTTACTAAAAGTAAGTTT Gene: CKO_03618: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
|
*
Enterobacter sp. 638 Site: position = -67 score = 6.28035 sequence = GTACTTACTATAAGTTAGTTA Gene: Ent638_0383: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
|
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -81 score = 6.12513 sequence = GTACTTACTTAAAGTTAGCTT Gene: ECA4449: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -67 score = 6.59987 sequence = GTACTTACTAAAAGTAAGTTT Gene: b4211: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -68 score = 6.28035 sequence = GTACTTACTAAAAGTTAGTTA Gene: KPN_04605: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
|
*
Proteus mirabilis HI4320 Site: position = -68 score = 6.59987 sequence = GTACTTACTTTTAGTAAGTTT Gene: PMI0976: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
*
Salmonella typhimurium LT2 Site: position = -67 score = 6.59987 sequence = GTACTTACTAAAAGTAAGTTT Gene: STM4401: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
|
*
Yersinia pestis KIM Site: position = -119 score = 5.8773 sequence = GTACTTACGTAAAGTGAGTAT Gene: y1806: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |