Propagation of PdhR regulog to Salmonella enterica subsp. enterica serovar Typhi str. E98-3139
Source regulog: | PdhR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Pyruvate metabolism |
Effector: | Pyruvate |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Salmonella enterica subsp. enterica serovar Typhi str. E98-3139 |
Orthologous TF(s) | Salmonellentericaenterica_010100000477 |
Regulated genes | 3 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -51
Score: 6.7 Sequence: GAAATTGGTAAGACCAATTGA
Locus tag: Salmonellentericaenterica_010100000477
|
||||
Salmonellentericaenterica_010100000477 | -51 | 6.7 | GAAATTGGTAAGACCAATTGA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: pdhR | ||||
Ortholog function: Transcriptional repressor for pyruvate dehydrogenase complex, GntR family | ||||
Escherichia coli str. K-12 substr. MG1655 | b0113 | -50 | 6.7 | GAAATTGGTAAGACCAATTGA |
Salmonella typhimurium LT2 | STM0151 | -51 | 6.7 | GAAATTGGTAAGACCAATTGA |
Citrobacter koseri ATCC BAA-895 | CKO_03260 | -51 | 6.7 | GAAATTGGTAAGACCAATTGA |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_00117 | -49 | 6.7 | TAAATTGGTAAGACCAATTGA |
Enterobacter sp. 638 | Ent638_0659 | -51 | 6.7 | GAAATTGGTAAGACCAATTGA |
Erwinia amylovora ATCC 49946 | EAM_0746 | -49 | 6.6 | TAAATTGGTATTACCAATTTA |
Yersinia pestis KIM | y0766 | -70 | 6.8 | GAAATTGGTATTACCAATTGA |
Serratia proteamaculans 568 | Spro_4012 | -52 | 6.8 | GAAATTGGTATTACCAATTGA |
Erwinia carotovora subsp. atroseptica SCRI1043 | ECA3790 | -51 | 6.8 | GAAATTGGTATTACCAATTGA |
Edwardsiella tarda EIB202 | ETAE_0658 | -74 | 6.5 | GAAATTGGTAATACCAATTTA |
Proteus mirabilis HI4320 | PMI2047 | -69 | 6.7 | TAAATTGGTATTACCAATTGA |
Photorhabdus luminescens subsp. laumondii TTO1 | plu3624 | -315 | 6.7 | TAAATTGGTATTACCAATTGA |
Position: -71
Score: 5.7 Sequence: AACAATGGTTTTACCAATTGG
Locus tag: Salmonellentericaenterica_010100008718
|
||||
Salmonellentericaenterica_010100008718 | -71 | 5.7 | AACAATGGTTTTACCAATTGG | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: yfiD | ||||
Ortholog function: stress-induced alternate pyruvate formate-lyase subunit | ||||
Salmonella typhimurium LT2 | STM2646 | -71 | 5.7 | AACAATGGTTTTACCAATTGG |
Citrobacter koseri ATCC BAA-895 | CKO_00205 | -70 | 5.7 | AACAATGGTTTTACCAATTGG |
Enterobacter sp. 638 | Ent638_3064 | -67 | 5.7 | AACAATGGTTTTACCAATTGG |
Position: -137
Score: 6.4 Sequence: AATTTTGGTATGACCAATGCA
Locus tag: Salmonellentericaenterica_010100023596
|
||||
Salmonellentericaenterica_010100023596 | -137 | 6.4 | AATTTTGGTATGACCAATGCA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: ndh | ||||
Ortholog function: NADH dehydrogenase | ||||
Escherichia coli str. K-12 substr. MG1655 | b1109 | -138 | 6.4 | AATTTTGGTATGACCAATGCA |
Salmonella typhimurium LT2 | STM1211 | -138 | 6.4 | AATTTTGGTATGACCAATGCA |
Citrobacter koseri ATCC BAA-895 | CKO_01946 | -151 | 6.4 | AATTTTGGTATGACCAATGCA |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_01106 | -136 | 6.4 | AATTTTGGTATGACCAATGCA |
Enterobacter sp. 638 | Ent638_1624 | -137 | 6.1 | AATTTTGGTATGACCAATGCG |
Yersinia pestis KIM | y1777 | -136 | 6.3 | AATTTTGGTATGACCATATGA |
Serratia proteamaculans 568 | Spro_1926 | -137 | 6.4 | AATTTTGGTATGACCAAATAA |
Erwinia carotovora subsp. atroseptica SCRI1043 | ECA1815 | -137 | 6.4 | AATTTTGGTATGACCAAATAA |
Edwardsiella tarda EIB202 | ETAE_2070 | -150 | 6.4 | AATTTTGGTATGACCAAATTA |
Proteus mirabilis HI4320 | PMI0875 | -141 | 5.7 | AACTTTGGTATGACCATATTG |
Photorhabdus luminescens subsp. laumondii TTO1 | plu2821 | -138 | 5.8 | AATTTTGGTATGACCCACTAA |