Propagation of CymR regulog to Bacillus cereus subsp. cytotoxis NVH 391-98
Source regulog: | CymR - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | Rrf2 |
Regulation mode: | repressor |
Biological process: | Cysteine metabolism |
Effector: | O-acetyl-L-serine; CysK, cysteine synthetase |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Bacillus cereus subsp. cytotoxis NVH 391-98 |
Orthologous TF(s) | Bcer98_3110 |
Regulated genes | 4 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -39
Score: 4.7 Sequence: GAAAACCAATAAAAATACTCGGTGTTA
Locus tag: Bcer98_0063
|
||||
Bcer98_0063 | -39 | 4.7 | GAAAACCAATAAAAATACTCGGTGTTA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: cysK | ||||
Ortholog function: Cysteine synthase (EC 2.5.1.47) | ||||
Bacillus subtilis subsp. subtilis str. 168 | BSU00730 | -39 | 5.4 | TAATACCAATACAAATAGTCGGAAATT |
Bacillus amyloliquefaciens FZB42 | RBAM_000840 | -39 | 5.8 | TAATACCAATAAATTTAGTCGGAAATT |
Bacillus pumilus SAFR-032 | BPUM_0057 | -40 | 4.6 | TtAaTaCaATaAAATTAcTcGGAgaTA |
Bacillus licheniformis DSM 13 | BLi00089 | -38 | 5.6 | TAATCCCAATAAAATTACTCGGAAATT |
Anoxybacillus flavithermus WK1 | Aflv_0065 | -30 | 5 | CAAATTCTATAAAAATACTCGGGATTA |
Geobacillus kaustophilus HTA426 | GK0065 | -38 | 4.7 | CAAAGTCGATAAAATTAATGGGGATTA |
Bacillus cereus ATCC 14579 | BC0075 | -39 | 5.3 | TAAAACCAATAAAAATACTCGGTGTTA |
Bacillus halodurans C-125 | BH0088 | -39 | 5.2 | GAAAACCAATAAATTTACTTGGGATTA |
Bacillus clausii KSM-K16 | ABC0109 | -42 | 4.9 | TAAAACCAATGAAGATACTAGGGATTG |
Oceanobacillus iheyensis HTE831 | OB0084 | -41 | 6 | TAAATCTTATAAAAATACTTGGAATTA |
Paenibacillus sp. JDR-2 | Pjdr2_0074 | -44 | 5.7 | AAAAACCAACTAAATTAGTCGGAATAA |
Position: -29
Score: 5.1 Sequence: TAAAACCGATAAGAAAAAGGGGAATTT
Locus tag: Bcer98_3087
|
||||
Bcer98_3087 | -29 | 5.1 | TAAAACCGATAAGAAAAAGGGGAATTT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: yrrT | ||||
Ortholog function: SAM-dependent methyltransferase | ||||
Bacillus subtilis subsp. subtilis str. 168 | BSU27280 | -49 | 6.1 | TAATCCATAGTATACTTATAGGAATTA |
Bacillus amyloliquefaciens FZB42 | RBAM_024380 | -49 | 5.9 | TAATCCATACTATACTCATAGGAATTA |
Bacillus pumilus SAFR-032 | BPUM_2363 | -51 | 5.4 | TAAAACATACTATACGCATAGGAATAA |
Bacillus licheniformis DSM 13 | BLi02856 | -54 | 5.8 | TAAATCATACTATACTTATAGGAATTG |
Anoxybacillus flavithermus WK1 | Aflv_0758 | -36 | 6.4 | TAATTCATACTATACTTATAGGAATTA |
Geobacillus kaustophilus HTA426 | GK2543 | -51 | 5.9 | AAAAACATACTATATTTATAGGAATTA |
Bacillus cereus ATCC 14579 | BC4369 | -29 | 5.1 | TAAAACCGATAAGAAAAAGGGGAATTT |
Paenibacillus sp. JDR-2 | Pjdr2_5106 | -105 | 5.2 | TAAATCCGATTAATAAGGTTGGAAAAA |