Propagation of PdhR regulog to Providencia alcalifaciens DSM 30120

Reference regulog properties
Source regulog:	PdhR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Pyruvate metabolism
Effector:	Pyruvate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Providencia alcalifaciens DSM 30120
Orthologous TF(s)	PROVALCAL_03873
Regulated genes	4

Built upon 44 sites [see more]

Predicted regulatory interactions in *Providencia alcalifaciens DSM 30120*
	Locus tag	Position	Score	Sequence
Position: -136 Score: 5.7 Sequence: ACATTTGGTATGACCAAATGT Locus tag: PROVALCAL_03918
	PROVALCAL_03918	-136	5.7	ACATTTGGTATGACCAAATGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ndh
Ortholog function: NADH dehydrogenase
Escherichia coli str. K-12 substr. MG1655	b1109	-138	6.4	AATTTTGGTATGACCAATGCA
Salmonella typhimurium LT2	STM1211	-138	6.4	AATTTTGGTATGACCAATGCA
Citrobacter koseri ATCC BAA-895	CKO_01946	-151	6.4	AATTTTGGTATGACCAATGCA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_01106	-136	6.4	AATTTTGGTATGACCAATGCA
Enterobacter sp. 638	Ent638_1624	-137	6.1	AATTTTGGTATGACCAATGCG
Yersinia pestis KIM	y1777	-136	6.3	AATTTTGGTATGACCATATGA
Serratia proteamaculans 568	Spro_1926	-137	6.4	AATTTTGGTATGACCAAATAA
Erwinia carotovora subsp. atroseptica SCRI1043	ECA1815	-137	6.4	AATTTTGGTATGACCAAATAA
Edwardsiella tarda EIB202	ETAE_2070	-150	6.4	AATTTTGGTATGACCAAATTA
Proteus mirabilis HI4320	PMI0875	-141	5.7	AACTTTGGTATGACCATATTG
Photorhabdus luminescens subsp. laumondii TTO1	plu2821	-138	5.8	AATTTTGGTATGACCCACTAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --