Propagation of TrpR regulog to Yersinia pestis FV-1

Built upon 44 sites [see more]

Predicted regulatory interactions in *Yersinia pestis FV-1*
	Locus tag	Position	Score	Sequence
Position: -33 Score: 6.1 Sequence: TGTACTAGTTAAATAGTACT Locus tag: YpesF_010100013349
	YpesF_010100013349	-33	6.1	TGTACTAGTTAAATAGTACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: trpR
Ortholog function: Trp operon repressor
Escherichia coli str. K-12 substr. MG1655	b4393	-66	5.3	CGTACTCTTTAGCGAGTACA
Salmonella typhimurium LT2	STM4583	-34	5.6	TGTACTCGTGTAACAGTACA
Citrobacter koseri ATCC BAA-895	CKO_03393	-97	6	CGTACTCGTTAAAGAGTACA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_04848	-65	5.7	TGTACTCGTTGAAGAGTACA
Enterobacter sp. 638	Ent638_0554	3	5.5	TGTACTcGTcAAagAGTACA
Erwinia amylovora ATCC 49946	EAM_0634	-33	6.2	TGTACTAGTTAAATAGTATG
Yersinia pestis KIM	y3726	-24	6.1	TGTACTAGTTAAATAGTACT
Serratia proteamaculans 568	Spro_0676	-30	6.2	TGTACTAGTTAAATAGTATG
Erwinia carotovora subsp. atroseptica SCRI1043	ECA3899	-30	6.2	CGTACTAGTTAAATAGTATG
Edwardsiella tarda EIB202	ETAE_0543	-44	5.6	TGTACTCGTTGAATAGTTCA
Proteus mirabilis HI4320	PMI3714	-39	5.2	TGTACTAGTTTATGAGTGTG
Photorhabdus luminescens subsp. laumondii TTO1	plu0557	-34	6.2	TGTACTAGTTAAATAGTATG

Position: -139 Score: 5 Sequence: TGTACCATTCAGCTAGTACA Locus tag: YpesF_010100014269
	YpesF_010100014269	-139	5	TGTACCATTCAGCTAGTACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mtr
Ortholog function: Tryptophan-specific transport protein
Yersinia pestis KIM	y2900	-139	5	TGTACCATTCAGCTAGTACA
Serratia proteamaculans 568	Spro_3236	-58	5.3	TGTACCATTGAGCTAGTACA
Edwardsiella tarda EIB202	ETAE_2287	-48	4.8	CGTACCATTGCGCTAGTACA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --