Propagation of PaaR regulog to Burkholderia thailandensis MSMB43

Reference regulog properties
Source regulog:	PaaR - Ralstonia
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Betaproteobacteria
Propagated regulon:
Target genome	Burkholderia thailandensis MSMB43
Orthologous TF(s)	Bpse38_010100017131
Regulated genes	2

Built upon 18 sites [see more]

Predicted regulatory interactions in *Burkholderia thailandensis MSMB43*
	Locus tag	Position	Score	Sequence
Position: -88 Score: 6.6 Sequence: ATTAACCGACCGGTTGGTCGAA Locus tag: Bpse38_010100016007
	Bpse38_010100016007	-88	6.6	ATTAACCGACCGGTTGGTCGAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: paaF2
Ortholog function: Enoyl-CoA hydratase (EC 4.2.1.17)
Ralstonia metallidurans CH34	Rmet_3162	-149	6.1	ATTAACCGACCAGTCGGTCGGC
Ralstonia pickettii 12J	Rpic_3114	-53	6.5	ATTAACCGACCGGTTGGTCGGC
Ralstonia solanacearum GMI1000	RSc2872	-53	6.5	ATTAACCGACCGGTTGGTCGGC

Position: -62 Score: 7.1 Sequence: ATTAACCGACCGGTCGGTTGGT Locus tag: Bpse38_010100017096
	Bpse38_010100017096	-62	7.1	ATTAACCGACCGGTCGGTTGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: paaA
Ortholog function: Phenylacetate-CoA oxygenase, PaaA subunit
Cupriavidus taiwanensis	RALTA_A2973	-83	6.2	ATTGACCGACCGGTCGGCTTAT
Ralstonia eutropha H16	H16_A3520	-79	5.7	ATTGACCGACCGGTCGGCATAT
Ralstonia eutropha JMP134	Reut_A3206	-95	6.2	ATTGACCGACCGGTCGGCTTAT
Ralstonia metallidurans CH34	Rmet_3369	-113	6.8	ATTGACCGACCGGTCGGTTTAT
Ralstonia pickettii 12J	Rpic_4567	-96	6.3	ATTGACCGACCGGTCGGACGGT
Ralstonia solanacearum GMI1000	RSp0604	-97	6.3	ATTGACCGACCGGTCGGACGAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --