Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of HrcA regulog to Ralstonia pickettii 12D

Reference regulog properties
Source regulog: HrcA - Ralstonia
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Proteobacteria/beta
Propagated regulon:
Target genome Ralstonia pickettii 12D
Orthologous TF(s) Rpic12D_2480
Regulated genes 1
Built upon 12 sites [see more]
Predicted regulatory interactions in Ralstonia pickettii 12D
Locus tag Position Score Sequence
Position: -70
Score: 7.4
Sequence: TTAGCACTCTTCCGGTCGGAGTGCTAA
Locus tag: Rpic12D_0249
Rpic12D_0249 -70 7.4 TTAGCACTCTTCCGGTCGGAGTGCTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: rpoH
Ortholog function: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
Ralstonia solanacearum GMI1000 RSc0374 -70 7.4 TTAGCACTCATCCAGCCGGAGTGCTAA
Ralstonia pickettii 12J Rpic_0230 -70 7.6 TTAGCACTCATCCGGTTGGAGTGCTAA
Ralstonia metallidurans CH34 Rmet_0272 -96 7.7 TTAGCACTCGTCCGGTTCGAGTGCTAA
Ralstonia eutropha JMP134 Reut_A0325 -104 7.9 TTAGCACTCACCCGGCTTGAGTGCTAA
Ralstonia eutropha H16 H16_A0354 -104 7.9 TTAGCACTCACCCGGCCTGAGTGCTAA
Cupriavidus taiwanensis RALTA_A0299 -108 7.7 TTAGCACTCACCCGGCCAGAGTGCTAA