Propagation of YfmP regulog to Paenibacillus sp. JDR-2
| Source regulog: | YfmP - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | repressor |
| Biological process: | Metal efflux |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Paenibacillus sp. JDR-2 |
| Orthologous TF(s) | Pjdr2_6009 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -107
Score: 6.5 Sequence: AAGTTAACGTTGACGTAAAGAT
Locus tag: Pjdr2_1878
|
||||
| Pjdr2_1878 | -107 | 6.5 | AAGTTAACGTTGACGTAAAGAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: yfmO | ||||
| Ortholog function: Metal efflux transporter, MFS_1 family | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU07400 | -68 | 7 | AACTTAACGTTTACGTTAAGGT |
| Bacillus amyloliquefaciens FZB42 | RBAM_007650 | -69 | 6.9 | AAGTTTACGTTTACGTTAAGGT |
| Bacillus pumilus SAFR-032 | BPUM_0693 | -71 | 6.6 | ACATTTACGTTTACGTTAAGGT |
| Bacillus licheniformis DSM 13 | BLi00774 | -65 | 6.8 | AACTTAACGTTTACGTAAAAGT |
| Bacillus cereus ATCC 14579 | BC5372 | -50 | 6.5 | AAGTTAACGTTAACGTAAAATG |
| Paenibacillus sp. JDR-2 | Pjdr2_1878 | -107 | 6.5 | AAGTTAACGTTGACGTAAAGAT |
| Paenibacillus sp. JDR-2 | Pjdr2_6008 | -69 | 6.5 | AAGTTAACGTTGACGTTAACAT |
|
Position: -69
Score: 6.5 Sequence: AAGTTAACGTTGACGTTAACAT
Locus tag: Pjdr2_6009
|
||||
| Pjdr2_6009 | -69 | 6.5 | AAGTTAACGTTGACGTTAACAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: yfmP | ||||
| Ortholog function: Transcriptional regulator of metal efflux transporter expression, MerR family | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU07390 | -68 | 7 | AACTTAACGTTTACGTTAAGGT |
| Bacillus amyloliquefaciens FZB42 | RBAM_007640 | -69 | 6.9 | AAGTTTACGTTTACGTTAAGGT |
| Bacillus pumilus SAFR-032 | BPUM_0692 | -71 | 6.6 | ACATTTACGTTTACGTTAAGGT |
| Bacillus licheniformis DSM 13 | BLi00773 | -65 | 6.8 | AACTTAACGTTTACGTAAAAGT |
| Bacillus cereus ATCC 14579 | BC5373 | -50 | 6.5 | AAGTTAACGTTAACGTAAAATG |
| Paenibacillus sp. JDR-2 | Pjdr2_6009 | -69 | 6.5 | AAGTTAACGTTGACGTTAACAT |