Propagation of PaaR regulog to Burkholderia sp. H160

Reference regulog properties
Source regulog:	PaaR - Ralstonia
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Betaproteobacteria
Propagated regulon:
Target genome	Burkholderia sp. H160
Orthologous TF(s)	BH160DRAFT_2490
Regulated genes	1

Built upon 18 sites [see more]

Predicted regulatory interactions in *Burkholderia sp. H160*
	Locus tag	Position	Score	Sequence
Position: -91 Score: 6.5 Sequence: ATTGACCGACCGGTTGGTTGGC Locus tag: BH160DRAFT_1650
	BH160DRAFT_1650	-91	6.5	ATTGACCGACCGGTTGGTTGGC
Supported by regulated orthologs from reference regulons
Ortholog gene name: paaF2
Ortholog function: Enoyl-CoA hydratase (EC 4.2.1.17)
Ralstonia metallidurans CH34	Rmet_3162	-149	6.1	ATTAACCGACCAGTCGGTCGGC
Ralstonia pickettii 12J	Rpic_3114	-53	6.5	ATTAACCGACCGGTTGGTCGGC
Ralstonia solanacearum GMI1000	RSc2872	-53	6.5	ATTAACCGACCGGTTGGTCGGC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --