Propagation of PaaR regulog to Ralstonia eutropha JMP134

Reference regulog properties
Source regulog:	PaaR - Ralstonia
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Betaproteobacteria
Propagated regulon:
Target genome	Ralstonia eutropha JMP134
Orthologous TF(s)	Reut_A3212
Regulated genes	3

Built upon 18 sites [see more]

Predicted regulatory interactions in *Ralstonia eutropha JMP134*
	Locus tag	Position	Score	Sequence
Position: -73 Score: 6.4 Sequence: ATTTACCGACCGGCCGGTTGGT Locus tag: Reut_A0110
	Reut_A0110	-73	6.4	ATTTACCGACCGGCCGGTTGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: paaG
Ortholog function: Enoyl-CoA hydratase (EC 4.2.1.17)
Cupriavidus taiwanensis	RALTA_A0085	-31	6.6	ATTAACCGACCGATCGGTTGGT
Ralstonia eutropha H16	H16_A0142	-72	6.2	ATTAACCGACCGATCGGTTGGC
Ralstonia eutropha JMP134	Reut_A0110	-73	6.4	ATTTACCGACCGGCCGGTTGGT

Position: -65 Score: 6 Sequence: ATTCACCGACCGATCGGTCGGT Position: -61 Score: 6.2 Sequence: ACCGACCGATCGGTCGGTTAAT Locus tag: Reut_A3015
	Reut_A3015	-65	6	ATTCACCGACCGATCGGTCGGT
		-61	6.2	ACCGACCGATCGGTCGGTTAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: paaF
Ortholog function: Enoyl-CoA hydratase (EC 4.2.1.17)
Cupriavidus taiwanensis	RALTA_A2763	-89	5.7	GCCGACCGACTGGTCGGTTTAT
Ralstonia eutropha H16	H16_A3311	-90	5.7	GCCGACCGACTGGTCGGTTTAT
Ralstonia eutropha JMP134	Reut_A3015	-61	6.2	ACCGACCGATCGGTCGGTTAAT
Ralstonia metallidurans CH34	Rmet_3163	-100	5.8	GCCGACCGACTGGTCGGTTAAT
Ralstonia pickettii 12J	Rpic_3115	-52	6.2	GCCGACCAACCGGTCGGTTAAT
Ralstonia solanacearum GMI1000	RSc2873	-48	6.2	GCCGACCAACCGGTCGGTTAAT

Position: -95 Score: 6.2 Sequence: ATTGACCGACCGGTCGGCTTAT Locus tag: Reut_A3206
	Reut_A3206	-95	6.2	ATTGACCGACCGGTCGGCTTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: paaA
Ortholog function: Phenylacetate-CoA oxygenase, PaaA subunit
Cupriavidus taiwanensis	RALTA_A2973	-83	6.2	ATTGACCGACCGGTCGGCTTAT
Ralstonia eutropha H16	H16_A3520	-79	5.7	ATTGACCGACCGGTCGGCATAT
Ralstonia eutropha JMP134	Reut_A3206	-95	6.2	ATTGACCGACCGGTCGGCTTAT
Ralstonia metallidurans CH34	Rmet_3369	-113	6.8	ATTGACCGACCGGTCGGTTTAT
Ralstonia pickettii 12J	Rpic_4567	-96	6.3	ATTGACCGACCGGTCGGACGGT
Ralstonia solanacearum GMI1000	RSp0604	-97	6.3	ATTGACCGACCGGTCGGACGAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Propagation of PaaR regulog to Ralstonia eutropha JMP134

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --