Propagation of HTCS_Ara-1 regulog to Bacteroides cellulosilyticus DSM 14838

Reference regulog properties
Source regulog:	HTCS_Ara-1 - Bacteroidaceae
Regulator type:	Transcription factor
Regulator family:	[Other]
Regulation mode:	activator
Biological process:	Arabinan utilization
Effector:	Arabinan
Phylum:	Bacteroidetes
Propagated regulon:
Target genome	Bacteroides cellulosilyticus DSM 14838
Orthologous TF(s)	BACCELL_02344, BACCELL_05305
Regulated genes	1

Built upon 12 sites [see more]

Predicted regulatory interactions in *Bacteroides cellulosilyticus DSM 14838*
	Locus tag	Position	Score	Sequence
Position: -268 Score: 7.8 Sequence: TGTCCACCTCAAATGTTCATTTGTCCACCT Locus tag: BACCELL_05304
	BACCELL_05304	-268	7.8	TGTCCACCTCAAATGTTCATTTGTCCACCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: abn2
Ortholog function: Arabinan endo-1,5-alpha-L-arabinosidase
Bacteroides cellulosilyticus DSM 14838	BACCELL_05304	-268	7.8	TGTCCACCTCAAATGTTCATTTGTCCACCT
Bacteroides dorei DSM 17855	BACDOR_01716	-159	7.4	TGTCCACCCTTTAAGCGATATTGTCCACCT
Bacteroides eggerthii DSM 20697	BACEGG_01542	-285	7.4	TGTCCACCTTAAAAGGTCATATATCCACCT
Bacteroides thetaiotaomicron VPI-5482	BT0367	-69	7	TGTCCACCAATCGTGTTCGTATGTCCACCT
Bacteroides vulgatus ATCC 8482	BVU_1002	-169	7.4	TGTCCACCCTTTAAGCGATATTGTCCACCT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --