Propagation of XylR regulog to Bacteroides cellulosilyticus DSM 14838

Reference regulog properties
Source regulog:	XylR - Bacteroidaceae
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose
Phylum:	Bacteroidetes
Propagated regulon:
Target genome	Bacteroides cellulosilyticus DSM 14838
Orthologous TF(s)	BACCELL_04758
Regulated genes	1

Built upon 43 sites [see more]

Predicted regulatory interactions in *Bacteroides cellulosilyticus DSM 14838*
	Locus tag	Position	Score	Sequence
Position: -161 Score: 5.9 Sequence: CTTATTGTATTTTAAACAAGAAG Locus tag: BACCELL_05612
	BACCELL_05612	-161	5.9	CTTATTGTATTTTAAACAAGAAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: tkt
Ortholog function: Transketolase (EC 2.2.1.1)
Bacteroides cellulosilyticus DSM 14838	BACCELL_05612	-161	5.9	CTTATTGTATTTTAAACAAGAAG
Bacteroides eggerthii DSM 20697	BACEGG_01528	-166	5.6	CTTATTGTAATCAAAACAAGAAG
Bacteroides ovatus ATCC 8483	BACOVA_01706	-128	5.6	CTTATTGTATCACAAACAAGAAG
Bacteroides stercoris ATCC 43183	BACSTE_01846	-161	5.3	GTTATTGTATTCAAAACAGGAAG
Bacteroides thetaiotaomicron VPI-5482	BT0347	-162	5.3	CTTACTGTATTGTAAACAAGAAG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --