Propagation of DVU0057 regulog to Desulfovibrio salexigens DSM 2638

Reference regulog properties
Source regulog:	DVU0057 - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:
Biological process:
Effector:
Phylum:	Proteobacteria/delta
Propagated regulon:
Target genome	Desulfovibrio salexigens DSM 2638
Orthologous TF(s)	Desal_0950
Regulated genes	1

Built upon 3 sites [see more]

Predicted regulatory interactions in *Desulfovibrio salexigens DSM 2638*
	Locus tag	Position	Score	Sequence
Position: -37 Score: 6.7 Sequence: GCTTCAAACAGTGTTTTAATT Locus tag: Desal_0950
	Desal_0950	-37	6.7	GCTTCAAACAGTGTTTTAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: Desal_0950
Ortholog function: transcriptional regulator, TetR family
Desulfovibrio salexigens DSM 2638	Desal_0950	-37	6.7	GCTTCAAACAGTGTTTTAATT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --