Propagation of RbsR regulog to Desulfovibrio salexigens DSM 2638

Reference regulog properties
Source regulog:	RbsR - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Phylum:	Proteobacteria/delta
Propagated regulon:
Target genome	Desulfovibrio salexigens DSM 2638
Orthologous TF(s)	Desal_2548
Regulated genes	1

Built upon 1 sites [see more]

Predicted regulatory interactions in *Desulfovibrio salexigens DSM 2638*
	Locus tag	Position	Score	Sequence
Position: -76 Score: 4.5 Sequence: TTGCGCAAACGTTTCGATGA Locus tag: Desal_2553
	Desal_2553	-76	4.5	TTGCGCAAACGTTTCGATGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: rbsD
Ortholog function: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Desulfovibrio salexigens DSM 2638	Desal_2553	-76	4.5	TTGCGCAAACGTTTCGATGA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --