Propagation of DVU0118 regulog to Desulfovibrio vulgaris str. DP4
| Source regulog: | DVU0118 - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | Fis |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Propagated regulon: | |
| Target genome | Desulfovibrio vulgaris str. DP4 |
| Orthologous TF(s) | Dvul_2845 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -166
Score: 6.3 Sequence: ATGTTCCCTCAAAGGAACAT
Locus tag: Dvul_2840
|
||||
| Dvul_2840 | -166 | 6.3 | ATGTTCCCTCAAAGGAACAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: DVU0123 | ||||
| Ortholog function: membrane protein, putative | ||||
| Desulfovibrio vulgaris Hildenborough | DVU0123 | -166 | 6.3 | ATGTTCCCTCAAAGGAACAT |
| Desulfovibrio vulgaris str. Miyazaki F | DvMF_1255 | -163 | 6.4 | ATGTTCCCGAATGGGAACAT |