Propagation of DVU0118 regulog to Desulfovibrio vulgaris str. Miyazaki F

Reference regulog properties
Source regulog:	DVU0118 - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	Fis
Regulation mode:
Biological process:
Effector:
Phylum:	Proteobacteria/delta
Propagated regulon:
Target genome	Desulfovibrio vulgaris str. Miyazaki F
Orthologous TF(s)	DvMF_1260
Regulated genes	1

Built upon 2 sites [see more]

Predicted regulatory interactions in *Desulfovibrio vulgaris str. Miyazaki F*
	Locus tag	Position	Score	Sequence
Position: -163 Score: 6.4 Sequence: ATGTTCCCGAATGGGAACAT Locus tag: DvMF_1255
	DvMF_1255	-163	6.4	ATGTTCCCGAATGGGAACAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: DVU0123
Ortholog function: membrane protein, putative
Desulfovibrio vulgaris Hildenborough	DVU0123	-166	6.3	ATGTTCCCTCAAAGGAACAT
Desulfovibrio vulgaris str. Miyazaki F	DvMF_1255	-163	6.4	ATGTTCCCGAATGGGAACAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --