Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of HisR regulog to Exiguobacterium sibiricum 255-15

Reference regulog properties
Source regulog: HisR - Bacillales
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Histidine biosynthesis
Effector: Histidine
Phylum: Firmicutes
Propagated regulon:
Target genome Exiguobacterium sibiricum 255-15
Orthologous TF(s) Exig_0460
Regulated genes 1
Built upon 20 sites [see more]
Predicted regulatory interactions in Exiguobacterium sibiricum 255-15
Locus tag Position Score Sequence
Position: -47
Score: 4.9
Sequence: TACTTTAGTATAGTACAGTG
Locus tag: Exig_1230
Exig_1230 -47 4.9 TACTTTAGTATAGTACAGTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: yuiF
Ortholog function: Histidine permease
Bacillus subtilis subsp. subtilis str. 168 BSU32040 -39 5.7 TACATTAGCAAACTAAAGGA
Bacillus amyloliquefaciens FZB42 RBAM_029090 -39 5.7 TACATTAGCAAACTAAAGGA
Bacillus pumilus SAFR-032 BPUM_2865 -36 5.8 TACATTAGTAAACTAAAGGA
Bacillus licheniformis DSM 13 BLi03386 -40 5.8 TACATTAGCAAACTAAAGTG
Anoxybacillus flavithermus WK1 Aflv_1385 -34 5.2 CAATTTATCAAACTAAAGTG
Bacillus halodurans C-125 BH3359 -47 5.1 TGATTTAATAAACTAAAGCA
Bacillus clausii KSM-K16 ABC2918 -30 4.8 TGATTTAATAAGATAAAGGA