Propagation of DvMF_2930 regulog to Desulfovibrio vulgaris str. Miyazaki F

Reference regulog properties
Source regulog:	DvMF_2930 - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:
Effector:
Phylum:	Proteobacteria/delta
Propagated regulon:
Target genome	Desulfovibrio vulgaris str. Miyazaki F
Orthologous TF(s)	DvMF_2930
Regulated genes	2

Built upon 2 sites [see more]

Predicted regulatory interactions in *Desulfovibrio vulgaris str. Miyazaki F*
	Locus tag	Position	Score	Sequence
Position: -54 Score: 5.6 Sequence: TCGGGCATTGACGATGCAACG Locus tag: DvMF_2925
	DvMF_2925	-54	5.6	TCGGGCATTGACGATGCAACG
Supported by regulated orthologs from reference regulons
Ortholog gene name: DvMF_2925
Ortholog function: 5-carboxymethyl-2-hydroxymuconate delta-isomerase( EC:5.3.3.10 )
Desulfovibrio vulgaris str. Miyazaki F	DvMF_2925	-54	5.6	TCGGGCATTGACGATGCAACG

Position: -59 Score: 6.3 Sequence: TTTTGCATTCTGCATGCAAAA Locus tag: DvMF_2930
	DvMF_2930	-59	6.3	TTTTGCATTCTGCATGCAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: DvMF_2930
Ortholog function: transcriptional regulator, GntR family
Desulfovibrio vulgaris str. Miyazaki F	DvMF_2930	-59	6.3	TTTTGCATTCTGCATGCAAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --