Propagation of DvMF_1479 regulog to Desulfovibrio vulgaris str. Miyazaki F

Reference regulog properties
Source regulog:	DvMF_1479 - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Amino acid transport
Effector:
Phylum:	Proteobacteria/delta
Propagated regulon:
Target genome	Desulfovibrio vulgaris str. Miyazaki F
Orthologous TF(s)	DvMF_1479
Regulated genes	1

Built upon 1 sites [see more]

Predicted regulatory interactions in *Desulfovibrio vulgaris str. Miyazaki F*
	Locus tag	Position	Score	Sequence
Position: -93 Score: 6.4 Sequence: CTTTGTATACGGTATGCAACG Locus tag: DvMF_1483
	DvMF_1483	-93	6.4	CTTTGTATACGGTATGCAACG
Supported by regulated orthologs from reference regulons
Ortholog gene name: DvMF_1483
Ortholog function: putative ABC transporter permease protein
Desulfovibrio vulgaris str. Miyazaki F	DvMF_1483	-93	6.4	CTTTGTATACGGTATGCAACG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --