Propagation of DVU0436 regulog to Desulfovibrio vulgaris str. Miyazaki F

Reference regulog properties
Source regulog:	DVU0436 - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:
Biological process:
Effector:
Phylum:	Proteobacteria/delta
Propagated regulon:
Target genome	Desulfovibrio vulgaris str. Miyazaki F
Orthologous TF(s)	DvMF_1517
Regulated genes	1

Built upon 2 sites [see more]

Predicted regulatory interactions in *Desulfovibrio vulgaris str. Miyazaki F*
	Locus tag	Position	Score	Sequence
Position: -160 Score: 7 Sequence: TTCTTAAACACTCGTTTAAGTA Locus tag: DvMF_1517
	DvMF_1517	-160	7	TTCTTAAACACTCGTTTAAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: DVU0436
Ortholog function: Transcriptional regulator, TetR family
Desulfovibrio vulgaris Hildenborough	DVU0436	10	7	TGGCTAAACGGTCGTTTAGAAA
Desulfovibrio vulgaris str. Miyazaki F	DvMF_1517	-160	7	TTCTTAAACACTCGTTTAAGTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --