Propagation of DVU0057 regulog to Desulfovibrio vulgaris str. Miyazaki F
| Source regulog: | DVU0057 - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Propagated regulon: | |
| Target genome | Desulfovibrio vulgaris str. Miyazaki F |
| Orthologous TF(s) | DvMF_2165 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -70
Score: 7 Sequence: GGTTCAAACAATGATTGAATT
Locus tag: DvMF_2165
|
||||
| DvMF_2165 | -70 | 7 | GGTTCAAACAATGATTGAATT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: DVU0057 | ||||
| Ortholog function: Transcriptional regulator, TetR family | ||||
| Desulfovibrio vulgaris Hildenborough | DVU0057 | -31 | 6.7 | GTTTCAAACAAGGGTTGAAAC |
| Desulfovibrio vulgaris str. Miyazaki F | DvMF_2165 | -70 | 7 | GGTTCAAACAATGATTGAATT |