Propagation of CcpN regulog to Exiguobacterium sibiricum 255-15
| Source regulog: | CcpN - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | CcpN |
| Regulation mode: | repressor |
| Biological process: | Gluconeogenesis |
| Effector: | |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Exiguobacterium sibiricum 255-15 |
| Orthologous TF(s) | No orthologous TFs found |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -58
Score: 4.5 Sequence: TAAATGTGTCATACTAATAGT
Locus tag: Exig_2285
|
||||
| Exig_2285 | -58 | 4.5 | TAAATGTGTCATACTAATAGT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: pckA | ||||
| Ortholog function: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU30560 | -61 | 5.1 | AATATATGTTATACTAATTCA |
| Bacillus amyloliquefaciens FZB42 | RBAM_027580 | -63 | 4.7 | GATATATGTTATACTAATTCC |
| Bacillus pumilus SAFR-032 | BPUM_2687 | -58 | 4.6 | TGAATGTGTTATACTAATCGA |
| Bacillus licheniformis DSM 13 | BLi03197 | -67 | 5.4 | TAAATGTGTTATACTAATTCT |
| -45 | 4.3 | CATTAATGTTATACACATTAA | ||
| Anoxybacillus flavithermus WK1 | Aflv_0413 | 28 | 5 | AAAATGTGTTATACTTTTTAC |
| Geobacillus kaustophilus HTA426 | GK2850 | -55 | 5.2 | AAAATGTGTTATACTATTTTC |
| Bacillus cereus ATCC 14579 | BC4762 | -69 | 4.8 | TAATTGTGTTATACTCTTGTT |
| Bacillus halodurans C-125 | BH3302 | -60 | 5.3 | TAAATGTGTTATACTAAATAA |
| Bacillus clausii KSM-K16 | ABC2879 | -51 | 4.6 | AAAATGTGTTATACTAAAGCC |
| Oceanobacillus iheyensis HTE831 | OB2315 | -88 | 5.3 | TTAATGTGTTATACTAATAAT |