Regulog CcpN - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | CcpN |
| Regulation mode: | repressor |
| Biological process: | Gluconeogenesis |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - CcpN
- By pathway - Gluconeogenesis
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 2 | 2 |
| Bacillus amyloliquefaciens FZB42 | 2 | 2 |
| Bacillus pumilus SAFR-032 | 2 | 2 |
| Bacillus licheniformis DSM 13 | 2 | 2 |
| Anoxybacillus flavithermus WK1 | 2 | 2 |
| Geobacillus kaustophilus HTA426 | 2 | 2 |
| Bacillus cereus ATCC 14579 | 2 | 2 |
| Bacillus halodurans C-125 | 2 | 2 |
| Bacillus clausii KSM-K16 | 2 | 2 |
| Oceanobacillus iheyensis HTE831 | 2 | 2 |
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| pckA |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -61 score = 5.05843 sequence = AATATATGTTATACTAATTCA Gene: BSU30560: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Bacillus amyloliquefaciens FZB42 Site: position = -63 score = 4.65162 sequence = GATATATGTTATACTAATTCC Gene: RBAM_027580: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Bacillus pumilus SAFR-032 Site: position = -58 score = 4.60502 sequence = TGAATGTGTTATACTAATCGA Gene: BPUM_2687: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Bacillus licheniformis DSM 13 Site: position = -67 score = 5.39027 sequence = TAAATGTGTTATACTAATTCT Site: position = -45 score = 4.34279 sequence = CATTAATGTTATACACATTAA Gene: BLi03197: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Anoxybacillus flavithermus WK1 Site: position = 28 score = 4.97728 sequence = AAAATGTGTTATACTTTTTAC Gene: Aflv_0413: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Geobacillus kaustophilus HTA426 Site: position = -55 score = 5.17161 sequence = AAAATGTGTTATACTATTTTC Gene: GK2850: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Bacillus cereus ATCC 14579 Site: position = -69 score = 4.82944 sequence = TAATTGTGTTATACTCTTGTT Gene: BC4762: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Bacillus halodurans C-125 Site: position = -60 score = 5.29782 sequence = TAAATGTGTTATACTAAATAA Gene: BH3302: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Bacillus clausii KSM-K16 Site: position = -51 score = 4.64983 sequence = AAAATGTGTTATACTAAAGCC Gene: ABC2879: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
*
Oceanobacillus iheyensis HTE831 Site: position = -88 score = 5.32513 sequence = TTAATGTGTTATACTAATAAT Gene: OB2315: Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
|
Phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49) |
| CRON 2. | ||||||||||||
| gapB |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -67 score = 5.51132 sequence = TTAATGTGTTATACTAATTTT Gene: BSU29020: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13) |
*
Bacillus amyloliquefaciens FZB42 Site: position = -68 score = 5.11257 sequence = TTAATGTGTTATACTATATAT Gene: RBAM_026060: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13) |
*
Bacillus pumilus SAFR-032 Site: position = -69 score = 4.44113 sequence = CTAATGTGATATACTAATTTC Site: position = -38 score = 5.13827 sequence = TTATTGAGTATAACACATAAT Gene: BPUM_2547: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13) |
*
Bacillus licheniformis DSM 13 Site: position = -68 score = 5.36347 sequence = ATAATGTGTTATACTTATTTT Gene: BLi03052: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13) |
*
Anoxybacillus flavithermus WK1 Site: position = -38 score = 5.18002 sequence = ATAAATAGTATAACACATATA Site: position = -70 score = 5.01773 sequence = TAAAAATGTTATACTATTTTT Gene: Aflv_0514: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13) |
*
Geobacillus kaustophilus HTA426 Site: position = -69 score = 4.78072 sequence = AAAATATGATATACTATTTAT Site: position = -38 score = 4.36391 sequence = GAAAATAGTATAACATATATG Gene: GK2726: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13) |
*
Bacillus cereus ATCC 14579 Site: position = -37 score = 4.70343 sequence = ATAAATAGTATAACGCATTCA Site: position = -68 score = 4.8268 sequence = TTTTTGTGTTATACTATTATT Gene: BC4583: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13) |
*
Bacillus halodurans C-125 Site: position = -66 score = 4.76365 sequence = TAAAAGTGATATACTATTTAT Gene: BH3149: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13) |
*
Bacillus clausii KSM-K16 Site: position = -71 score = 4.67095 sequence = TATTTATGTTATACTATTTCA Gene: ABC2705: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13) |
*
Oceanobacillus iheyensis HTE831 Site: position = -36 score = 4.38071 sequence = GTTATGAGTATATCATAATTA Site: position = -66 score = 5.17571 sequence = AATTTGTGTTATACTAATTAT Gene: OB2160: NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13) |
|
NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |