Propagation of MtlR regulog to Staphylococcus aureus subsp. aureus str. Newman
Source regulog: | MtlR - Staphylococcaceae |
Regulator type: | Transcription factor |
Regulator family: | BglG |
Regulation mode: | activator |
Biological process: | Mannitol utilization |
Effector: | MtlA, mannitol-specific enzyme IICB PTS component; HPr, phosphocarrier protein |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Staphylococcus aureus subsp. aureus str. Newman |
Orthologous TF(s) | NWMN_2058 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -104
Score: 6.5 Sequence: TTGTCACATTTATTTTGACAA
Locus tag: NWMN_2057
|
||||
NWMN_2057 | -104 | 6.5 | TTGTCACATTTATTTTGACAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: mtlF | ||||
Ortholog function: mannitol specific PTS system, IIBC component | ||||
Staphylococcus aureus subsp. aureus N315 | SA1960 | -104 | 6.5 | TTGTCACATTTATTTTGACAA |
Staphylococcus capitis SK14 | STACA0001_0858 | -108 | 6.2 | TTGTCACAAATATCATGACAA |
Staphylococcus carnosus subsp. carnosus TM300 | Sca_1658 | -105 | 5.3 | ATGGCAACAATTCAGTGACAA |
Staphylococcus haemolyticus JCSC1435 | SH0235 | -105 | 6.8 | TTGTCACAATTACTGTGACAA |
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | SSP0728 | -106 | 6.6 | TTGTCAAAGATACTGTGACAA |