Propagation of SO0072 regulog to Shewanella frigidimarina NCIMB 400
| Source regulog: | SO0072 - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Hypothetical ABC transporter |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Shewanella frigidimarina NCIMB 400 |
| Orthologous TF(s) | Sfri_3976 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -34
Score: 7.1 Sequence: TGTATCAATGTATTAATACA
Locus tag: Sfri_3976
|
||||
| Sfri_3976 | -34 | 7.1 | TGTATCAATGTATTAATACA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: SO0072 | ||||
| Ortholog function: Transcriptional regulator, GntR family, YtrA subfamily | ||||
| Shewanella sp ANA-3 | Shewana3_0077 | -34 | 7.1 | TGTATCAATGTATTAATACA |
| Shewanella sp MR-4 | Shewmr4_0075 | -34 | 7.1 | TGTATCAATGTATTAATACA |
| Shewanella sp MR-7 | Shewmr7_0073 | -34 | 7.1 | TGTATCAATGTATTAATACA |
| Shewanella frigidimarina NCIMB 400 | Sfri_3976 | -34 | 7.1 | TGTATCAATGTATTAATACA |
| Shewanella loihica PV-4 | Shew_3779 | -34 | 7.1 | TGTATCAATGTATTAATACA |
|
Position: -80
Score: 7.1 Sequence: TGTATTAATACATTGATACA
Locus tag: Sfri_3977
|
||||
| Sfri_3977 | -80 | 7.1 | TGTATTAATACATTGATACA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: PF00561 | ||||
| Ortholog function: Hydrolase, alpha/beta hydrolase fold family | ||||
| Shewanella oneidensis MR-1 | SO0071 | -78 | 7.1 | TGTATTAATACATTGATACA |
| Shewanella putrefaciens CN-32 | Sputcn32_0057 | -79 | 7.1 | TGTATTAATACATTGATACA |
| Shewanella sp W3-18-1 | Sputw3181_4021 | -79 | 7.1 | TGTATTAATACATTGATACA |
| Shewanella sp ANA-3 | Shewana3_0076 | -78 | 7.1 | TGTATTAATACATTGATACA |
| Shewanella sp MR-4 | Shewmr4_0074 | -78 | 7.1 | TGTATTAATACATTGATACA |
| Shewanella sp MR-7 | Shewmr7_0072 | -78 | 7.1 | TGTATTAATACATTGATACA |
| Shewanella baltica OS155 | Sbal_4278 | -79 | 7.1 | TGTATTAATACATTGATACA |
| Shewanella denitrificans OS217 | Sden_0068 | -73 | 6.9 | TGTATTAATTCATTGATACA |
| Shewanella frigidimarina NCIMB 400 | Sfri_3977 | -80 | 7.1 | TGTATTAATACATTGATACA |
| Shewanella amazonensis SB2B | Sama_3575 | -83 | 6.1 | TGAATCACTGTATTAATACA |
| -75 | 7.1 | TGTATTAATACATTGATACA | ||
| Shewanella loihica PV-4 | Shew_3780 | -101 | 7.1 | TGTATTAATACATTGATACA |
| Shewanella pealeana ATCC 700345 | Spea_4190 | -76 | 7.1 | TGTATTAATACATTGATACA |
| Shewanella piezotolerans WP3 | swp_0108 | -133 | 7.1 | TGTATTAATACATTGATACA |
| Shewanella woodyi ATCC 51908 | Swoo_4864 | -75 | 7.1 | TGTATTAATACATTGATACA |