Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of NsrR regulog to Shewanella denitrificans OS217

Reference regulog properties
Source regulog: NsrR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Nitrosative stress response
Effector: Nitric oxide
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shewanella denitrificans OS217
Orthologous TF(s) Sden_3702
Regulated genes 1
Built upon 51 sites [see more]
Predicted regulatory interactions in Shewanella denitrificans OS217
Locus tag Position Score Sequence
Position: -111
Score: 4.4
Sequence: ACAATCATTATAAATACCTGT
Locus tag: Sden_2837
Sden_2837 -111 4.4 ACAATCATTATAAATACCTGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nnrS2
Ortholog function: NnrS protein involved in response to NO
Shewanella sp ANA-3 Shewana3_2362 -46 4.5 AAGTGCAATTATTATGAAGCT
Shewanella denitrificans OS217 Sden_2837 -110 4.4 ACAatCATtaTAaATaCcTGT
Shewanella frigidimarina NCIMB 400 Sfri_3037 -64 5.6 AGATTTATATATTATGCATGT
Shewanella pealeana ATCC 700345 Spea_1227 -35 4.8 AGCTGTATTTTAAATGCGTGT
Shewanella piezotolerans WP3 swp_3404 -39 4.2 AggTaCATtaAAaATaCcTGT