Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CalR regulog to Shewanella denitrificans OS217

Reference regulog properties
Source regulog: CalR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Utilization of aromatic compounds
Effector:
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shewanella denitrificans OS217
Orthologous TF(s) Sden_0974
Regulated genes 1
Built upon 16 sites [see more]
Predicted regulatory interactions in Shewanella denitrificans OS217
Locus tag Position Score Sequence
Position: -45
Score: 6.8
Sequence: ACCCGACTGATTAGTCGGTT
Locus tag: Sden_0975
Sden_0975 -45 6.8 ACCCGACTGATTAGTCGGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: calB
Ortholog function: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
Shewanella oneidensis MR-1 SO_3683 -78 7.2 AACCGACTAATCAGTCGGTT
Shewanella putrefaciens CN-32 Sputcn32_2982 -104 6.9 AACCGACTAATCAGTCGGTA
Shewanella sp W3-18-1 Sputw3181_0965 -104 6.9 AACCGACTAATCAGTCGGTA
Shewanella sp ANA-3 Shewana3_3251 -78 7.2 AACCGACTAATCAGTCGGTT
Shewanella sp MR-4 Shewmr4_0872 -78 7.2 AACCGACTAATCAGTCGGTT
Shewanella sp MR-7 Shewmr7_3150 -78 7.2 AACCGACTAATCAGTCGGTT
Shewanella baltica OS155 Sbal_3332 -125 6.9 AACCGACTAATCAGTCGGTA
Shewanella denitrificans OS217 Sden_0975 -45 6.8 ACCCGACTGATTAGTCGGTT
Shewanella frigidimarina NCIMB 400 Sfri_0937 -82 7.1 GACCGACTAATCAGTCGGTT
Shewanella amazonensis SB2B Sama_2855 -43 7.1 GACCGACTAATCAGTCGGTT
Shewanella loihica PV-4 Shew_3103 -127 7.1 GACCGACTAATCAGTCGGTT
Shewanella pealeana ATCC 700345 Spea_3357 -49 7.1 GACCGACTAATCAGTCGGTT
Shewanella halifaxensis HAW-EB4 Shal_3429 -49 7 GACCGACTAATCAGTCGGTC
Shewanella piezotolerans WP3 swp_1052 -50 7.1 GACCGACTAATCAGTCGGTT
Shewanella sediminis HAW-EB3 Ssed_3716 -203 7.1 GACCGACTAATCAGTCGGTT
Shewanella woodyi ATCC 51908 Swoo_4064 -77 6.6 GACCGACCAATCAGTCGGTT