Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SO4705 regulog to Shewanella amazonensis SB2B

Reference regulog properties
Source regulog: SO4705 - Shewanellaceae
Regulator type: Transcription factor
Regulator family: XRE
Regulation mode: repressor
Biological process:
Effector:
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shewanella amazonensis SB2B
Orthologous TF(s) Sama_0680
Regulated genes 2
Built upon 32 sites [see more]
Predicted regulatory interactions in Shewanella amazonensis SB2B
Locus tag Position Score Sequence
Position: -65
Score: 6.6
Sequence: TTTTAGTCTATGTTATTTTTTACTACAA
Locus tag: Sama_0680
Sama_0680 -65 6.6 TTTTAGTCTATGTTATTTTTTACTACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO4705
Ortholog function: transcriptional regulator, XRE family
Shewanella oneidensis MR-1 SO_4705 -86 7.4 TTGTAGTCTAGTGTATTTTTTACTACAA
Shewanella putrefaciens CN-32 Sputcn32_3866 -65 7.3 TTGTAGTCTAGTCTTTTTTTGACTACAA
Shewanella sp W3-18-1 Sputw3181_0087 -65 7.3 TTGTAGTCTAGTCTTTTTTTGACTACAA
Shewanella sp ANA-3 Shewana3_4059 -65 7.3 TTGTAGTCTAGTCTTTTTTTGACTACAA
Shewanella sp MR-4 Shewmr4_3851 -65 7 TTGTAGTCTAGTCTTTTTTTGGCTACAA
Shewanella sp MR-7 Shewmr7_3944 -65 7.3 TTGTAGTCTAGTCTTTTTTTGACTACAA
Shewanella baltica OS155 Sbal_0106 -65 7.3 TTGTAGTCTAGTCTTTTTTTGACTACAA
Shewanella denitrificans OS217 Sden_0218 -65 7 TTGTAGTCTAAAACAATTTTCGCTACAA
Shewanella frigidimarina NCIMB 400 Sfri_3903 -64 4.8 TTtTAGTCTAtgcTATTTTTacaaACAA
Shewanella amazonensis SB2B Sama_0680 -65 6.6 TTTTAGTCTATGTTATTTTTTACTACAA
Shewanella loihica PV-4 Shew_2560 -65 6.6 TTGTAGTCTAGCGGCTTTTTCATTACAA
Shewanella pealeana ATCC 700345 Spea_2004 -65 7 TTGTAGTCTAGTGTAATTTTCATTACAA
Shewanella halifaxensis HAW-EB4 Shal_2297 -65 6.9 TTGTAGTCTAGTGTAAATTTTATTACAA
Shewanella piezotolerans WP3 swp_2678 -65 5.7 TTGTAGTCTAGTGTAAAAACCGCTACAA
Shewanella sediminis HAW-EB3 Ssed_1608 -65 7.1 TTGTAGTCTAGCGAATTTTTTACTACAA
Shewanella woodyi ATCC 51908 Swoo_3044 -84 6.8 TTGTAGTCTAGCTAATTTTTCATTACAA
Position: -119
Score: 6.6
Sequence: TTGTAGTAAAAAATAACATAGACTAAAA
Locus tag: Sama_0681
Sama_0681 -119 6.6 TTGTAGTAAAAAATAACATAGACTAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO4706
Ortholog function: Malate synthase-related protein
Shewanella oneidensis MR-1 SO_4706 -174 7.4 TTGTAGTAAAAAATACACTAGACTACAA
Shewanella putrefaciens CN-32 Sputcn32_3867 -216 7.3 TTGTAGTCAAAAAAAGACTAGACTACAA
Shewanella sp W3-18-1 Sputw3181_0086 -216 7.3 TTGTAGTCAAAAAAAGACTAGACTACAA
Shewanella sp ANA-3 Shewana3_4060 -171 7.3 TTGTAGTCAAAAAAAGACTAGACTACAA
Shewanella sp MR-4 Shewmr4_3852 -172 7 TTGTAGCCAAAAAAAGACTAGACTACAA
Shewanella sp MR-7 Shewmr7_3945 -171 7.3 TTGTAGTCAAAAAAAGACTAGACTACAA
Shewanella baltica OS155 Sbal_0105 -214 7.3 TTGTAGTCAAAAAAAGACTAGACTACAA
Shewanella denitrificans OS217 Sden_0217 -128 7 TTGTAGCGAAAATTGTTTTAGACTACAA
Shewanella frigidimarina NCIMB 400 Sfri_3904 -111 4.8 TTGTttgtAAAAATAgcaTAGACTAaAA
Shewanella amazonensis SB2B Sama_0681 -119 6.6 TTGTAGTAAAAAATAACATAGACTAAAA
Shewanella pealeana ATCC 700345 Spea_2005 -112 7 TTGTAATGAAAATTACACTAGACTACAA
Shewanella halifaxensis HAW-EB4 Shal_2296 -113 6.9 TTGTAATAAAATTTACACTAGACTACAA
Shewanella piezotolerans WP3 swp_2677 -120 5.7 TTGTAGCGGTTTTTACACTAGACTACAA
Shewanella sediminis HAW-EB3 Ssed_1609 -170 7.1 TTGTAGTAAAAAATTCGCTAGACTACAA
Shewanella woodyi ATCC 51908 Swoo_3043 -137 6.8 TTGTAATGAAAAATTAGCTAGACTACAA