Propagation of SO0072 regulog to Shewanella amazonensis SB2B
Source regulog: | SO0072 - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Hypothetical ABC transporter |
Effector: | |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Shewanella amazonensis SB2B |
Orthologous TF(s) | Sama_3574 |
Regulated genes | 2 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -34
Score: 7.1 Sequence: TGTATCAATGTATTAATACA
Locus tag: Sama_3574
|
||||
Sama_3574 | -34 | 7.1 | TGTATCAATGTATTAATACA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: SO0072 | ||||
Ortholog function: Transcriptional regulator, GntR family, YtrA subfamily | ||||
Shewanella oneidensis MR-1 | SO_0072 | -34 | 7.1 | TGTATCAATGTATTAATACA |
Shewanella putrefaciens CN-32 | Sputcn32_0058 | -34 | 7.1 | TGTATCAATGTATTAATACA |
Shewanella sp W3-18-1 | Sputw3181_4020 | -34 | 7.1 | TGTATCAATGTATTAATACA |
Shewanella baltica OS155 | Sbal_4277 | -34 | 7.1 | TGTATCAATGTATTAATACA |
Shewanella denitrificans OS217 | Sden_0069 | -34 | 6.9 | TGTATCAATGAATTAATACA |
Shewanella amazonensis SB2B | Sama_3574 | -34 | 7.1 | TGTATCAATGTATTAATACA |
Shewanella pealeana ATCC 700345 | Spea_4189 | -34 | 7.1 | TGTATCAATGTATTAATACA |
Shewanella piezotolerans WP3 | swp_0109 | -34 | 7.1 | TGTATCAATGTATTAATACA |
Shewanella woodyi ATCC 51908 | Swoo_4863 | -34 | 7.1 | TGTATCAATGTATTAATACA |
Position: -75
Score: 7.1 Sequence: TGTATTAATACATTGATACA
Locus tag: Sama_3575
|
||||
Sama_3575 | -75 | 7.1 | TGTATTAATACATTGATACA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: PF00561 | ||||
Ortholog function: Hydrolase, alpha/beta hydrolase fold family | ||||
Shewanella oneidensis MR-1 | SO0071 | -78 | 7.1 | TGTATTAATACATTGATACA |
Shewanella putrefaciens CN-32 | Sputcn32_0057 | -79 | 7.1 | TGTATTAATACATTGATACA |
Shewanella sp W3-18-1 | Sputw3181_4021 | -79 | 7.1 | TGTATTAATACATTGATACA |
Shewanella sp ANA-3 | Shewana3_0076 | -78 | 7.1 | TGTATTAATACATTGATACA |
Shewanella sp MR-4 | Shewmr4_0074 | -78 | 7.1 | TGTATTAATACATTGATACA |
Shewanella sp MR-7 | Shewmr7_0072 | -78 | 7.1 | TGTATTAATACATTGATACA |
Shewanella baltica OS155 | Sbal_4278 | -79 | 7.1 | TGTATTAATACATTGATACA |
Shewanella denitrificans OS217 | Sden_0068 | -73 | 6.9 | TGTATTAATTCATTGATACA |
Shewanella frigidimarina NCIMB 400 | Sfri_3977 | -80 | 7.1 | TGTATTAATACATTGATACA |
Shewanella amazonensis SB2B | Sama_3575 | -83 | 6.1 | TGAATCACTGTATTAATACA |
-75 | 7.1 | TGTATTAATACATTGATACA | ||
Shewanella loihica PV-4 | Shew_3780 | -101 | 7.1 | TGTATTAATACATTGATACA |
Shewanella pealeana ATCC 700345 | Spea_4190 | -76 | 7.1 | TGTATTAATACATTGATACA |
Shewanella piezotolerans WP3 | swp_0108 | -133 | 7.1 | TGTATTAATACATTGATACA |
Shewanella woodyi ATCC 51908 | Swoo_4864 | -75 | 7.1 | TGTATTAATACATTGATACA |