Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SoxR regulog to Teredinibacter turnerae T7901

Reference regulog properties
Source regulog: SoxR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: repressor
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Teredinibacter turnerae T7901
Orthologous TF(s) TERTU_2054
Regulated genes 2
Built upon 12 sites [see more]
Error

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

The page you are looking for does not exist.

© 2009-2020 RegPrecise
Predicted regulatory interactions in Teredinibacter turnerae T7901
Locus tag Position Score Sequence
Position: -41
Score: 4.6
Sequence: AATTAAAGCGAGCTTTAAGT
Locus tag: TERTU_2054
TERTU_2054 -41 4.6 AATTAAAGCGAGCTTTAAGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: soxR
Ortholog function: Redox-sensitive transcriptional activator, MerR family
Shewanella amazonensis SB2B Sama_3347 -32 6.2 ACTTCAAGTCAACTTGAGGT
Shewanella loihica PV-4 Shew_0423 -32 5.7 ACTTCAAGTCGACTTGAGGT
Shewanella woodyi ATCC 51908