Propagation of ManR1 regulog to Shewanella sp MR-7

Reference regulog properties
Source regulog:	ManR1 - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Mannose utilization; Mannosides utilization
Effector:	Mannose
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Shewanella sp MR-7
Orthologous TF(s)	Shewmr7_3383
Regulated genes	2

Built upon 4 sites [see more]

Predicted regulatory interactions in *Shewanella sp MR-7*
	Locus tag	Position	Score	Sequence
Position: -103 Score: 6.7 Sequence: TTTTTGGAACGTTCCAATTT Locus tag: Shewmr7_3383
	Shewmr7_3383	-103	6.7	TTTTTGGAACGTTCCAATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: manR1
Ortholog function: Transcriptional regulator of mannoside utilization, LacI family
Shewanella sp MR-7	Shewmr7_3383	-103	6.7	TTTTTGGAACGTTCCAATTT
Shewanella amazonensis SB2B	Sama_0565	-103	7.1	CAATTGGAACGTTCCAATTT

Position: -76 Score: 6.7 Sequence: AAATTGGAACGTTCCAAAAA Locus tag: Shewmr7_3384
	Shewmr7_3384	-76	6.7	AAATTGGAACGTTCCAAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mnnA1
Ortholog function: Alpha-1,2-mannosidase
Shewanella sp MR-7	Shewmr7_3384	-76	6.7	AAATTGGAACGTTCCAAAAA
Shewanella amazonensis SB2B	Sama_0564	-76	7.1	AAATTGGAACGTTCCAATTG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --