Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SoxR regulog to Moritella sp. PE36

Reference regulog properties
Source regulog: SoxR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: repressor
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Moritella sp. PE36
Orthologous TF(s) PE36_09316
Regulated genes 1
Built upon 12 sites [see more]
Predicted regulatory interactions in Moritella sp. PE36
Locus tag Position Score Sequence
Position: -66
Score: 6.3
Sequence: ACCTCAAGTTATGTTGAGGT
Locus tag: PE36_09316
PE36_09316 -66 6.3 ACCTCAAGTTATGTTGAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: soxR
Ortholog function: Redox-sensitive transcriptional activator, MerR family
Shewanella denitrificans OS217 Sden_2125 -116 7.3 ACCTCAAGTTAGCTTGAGGT
Shewanella frigidimarina NCIMB 400 Sfri_1565 -64 7 ACCTAAAGCTAACTTGAGGT
Shewanella piezotolerans WP3 swp_2307 -49 6 ATCTCAAGTTAACTTTAGAT