Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing xtpG gene

Properties
Regulog: XylR - Thermotogales
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Xylose utilization
Effector: Xylose; Glucose
Phylum: Thermotogae
Built upon 39 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga maritima MSB8
Position: -254
Score: 5.76129
Sequence: GTTATTTTTTGTAAAGAAAAAAT
Locus tag: TM0060
Name: xtpF
Funciton: Xylan oligosaccharide ABC transporter, permease component 1
Locus tag: TM0059
Name: xtpG
Funciton: Xylan oligosaccharide ABC transporter, permease component 2
Locus tag: TM0058
Name: xtpK
Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 1
Locus tag: TM0057
Name: xtpL
Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 2
Locus tag: TM0056
Name: xtpE
Funciton: Xylan oligosaccharide ABC transporter, substrate-binding component
Locus tag: TM0055
Name: aguA
Funciton: Alpha-glucuronidase (EC 3.2.1.139)
xtpF-xtpG-xtpK-xtpL-xtpE-aguA -254 5.8 GTTATTTTTTGTAAAGAAAAAAT TM0060
Thermotoga naphthophila RKU-10
Position: -253
Score: 5.76129
Sequence: GTTATTTTTTGTAAAGAAAAAAT
Locus tag: Tnap_0690
Name: xtpF
Funciton: Xylan oligosaccharide ABC transporter, permease component 1
Locus tag: Tnap_0689
Name: xtpG
Funciton: Xylan oligosaccharide ABC transporter, permease component 2
Locus tag: Tnap_0688
Name: xtpK
Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 1
Locus tag: Tnap_0687
Name: xtpL
Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 2
Locus tag: Tnap_0686
Name: xtpE
Funciton: Xylan oligosaccharide ABC transporter, substrate-binding component
Locus tag: Tnap_0685
Name: aguA
Funciton: Alpha-glucuronidase (EC 3.2.1.139)
xtpF-xtpG-xtpK-xtpL-xtpE-aguA -253 5.8 GTTATTTTTTGTAAAGAAAAAAT Tnap_0690
Thermotoga neapolitana DSM 4359
Position: -245
Score: 5.28183
Sequence: GTTATTTCTTACGGAGAAAAAAT
Locus tag: CTN_0633
Name: null
Funciton: Transposase, IS605 OrfB family
Locus tag: CTN_0634
Name: xtpF
Funciton: Xylan oligosaccharide ABC transporter, permease component 1
Locus tag: CTN_0635
Name: xtpG
Funciton: Xylan oligosaccharide ABC transporter, permease component 2
Locus tag: CTN_0636
Name: xtpK
Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 1
Locus tag: CTN_0637
Name: xtpL
Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 2
Locus tag: CTN_0638
Name: xtpE
Funciton: Xylan oligosaccharide ABC transporter, substrate-binding component
Locus tag: CTN_0639
Name: aguA
Funciton: Alpha-glucuronidase (EC 3.2.1.139)
CTN_0633-xtpF-xtpG-xtpK-xtpL-xtpE-aguA -245 5.3 GTTATTTCTTACGGAGAAAAAAT CTN_0633
Thermotoga petrophila RKU-1
Position: -255
Score: 5.76129
Sequence: GTTATTTTTTGTAAAGAAAAAAT
Locus tag: Tpet_0864
Name: xtpF
Funciton: Xylan oligosaccharide ABC transporter, permease component 1
Locus tag: Tpet_0865
Name: xtpG
Funciton: Xylan oligosaccharide ABC transporter, permease component 2
Locus tag: Tpet_0866
Name: xtpK
Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 1
Locus tag: Tpet_0867
Name: xtpL
Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 2
Locus tag: Tpet_0868
Name: xtpE
Funciton: Xylan oligosaccharide ABC transporter, substrate-binding component
Locus tag: Tpet_0869
Name: aguA
Funciton: Alpha-glucuronidase (EC 3.2.1.139)
xtpF-xtpG-xtpK-xtpL-xtpE-aguA -255 5.8 GTTATTTTTTGTAAAGAAAAAAT Tpet_0864
Thermotoga sp. RQ2
Position: -254
Score: 5.76129
Sequence: GTTATTTTTTGTAAAGAAAAAAT
Locus tag: TRQ2_0886
Name: xtpF
Funciton: Xylan oligosaccharide ABC transporter, permease component 1
Locus tag: TRQ2_0887
Name: xtpG
Funciton: Xylan oligosaccharide ABC transporter, permease component 2
Locus tag: TRQ2_0888
Name: xtpK
Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 1
Locus tag: TRQ2_0889
Name: xtpL
Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 2
Locus tag: TRQ2_0890
Name: xtpE
Funciton: Xylan oligosaccharide ABC transporter, substrate-binding component
Locus tag: TRQ2_0891
Name: aguA
Funciton: Alpha-glucuronidase (EC 3.2.1.139)
xtpF-xtpG-xtpK-xtpL-xtpE-aguA -254 5.8 GTTATTTTTTGTAAAGAAAAAAT TRQ2_0886