Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing CTN_0617 gene

Properties
Regulog: XylR - Thermotogales
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Xylose utilization
Effector: Xylose; Glucose
Phylum: Thermotogae
Built upon 39 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga neapolitana DSM 4359
Position: -52
Score: 5.82684
Sequence: AATATTTCCCGAAAGGAAAAAAT
Locus tag: CTN_0622
Name: xloE
Funciton: Xylose oligosaccharides ABC transporter, sugar-binding protein
Locus tag: CTN_0621
Name: xloF
Funciton: Xylose oligosaccharides ABC transporter, permease protein 1
Locus tag: CTN_0620
Name: xloG
Funciton: Xylose oligosaccharides ABC transporter, permease protein 2
Locus tag: CTN_0619
Name: xloK
Funciton: Xylose oligosaccharides ABC transporter, ATP-binding protein 1
Locus tag: CTN_0618
Name: xloL
Funciton: Xylose oligosaccharides ABC transporter, ATP-binding protein 2
Locus tag: CTN_0617
Name: null
Funciton: Endo-1,3-beta-xylanase
Locus tag: CTN_0616
Name: xyl3
Funciton: Beta-xylosidase (EC 3.2.1.37)
Locus tag: CTN_0615
Name: axeA
Funciton: Acetyl xylan esterase (EC 3.1.1.41)
xloE-xloF-xloG-xloK-xloL-CTN_0617-xyl3-axeA -52 5.8 AATATTTCCCGAAAGGAAAAAAT CTN_0622
© 2009-2020 RegPrecise